ID: 1139945125

View in Genome Browser
Species Human (GRCh38)
Location 16:70635590-70635612
Sequence GGAGCTGTTTCCAGTGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139945122_1139945125 10 Left 1139945122 16:70635557-70635579 CCTTCAGCAGAACATCGGCAGCT 0: 1
1: 1
2: 0
3: 7
4: 81
Right 1139945125 16:70635590-70635612 GGAGCTGTTTCCAGTGTTCAAGG 0: 1
1: 0
2: 2
3: 17
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139945125 Original CRISPR GGAGCTGTTTCCAGTGTTCA AGG Intronic