ID: 1139946263

View in Genome Browser
Species Human (GRCh38)
Location 16:70644690-70644712
Sequence CAGGGTGAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6109
Summary {0: 1, 1: 9, 2: 111, 3: 1046, 4: 4942}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139946263 Original CRISPR CAGGGTGAGGAGGAGGAGGA GGG Intronic
Too many off-targets to display for this crispr