ID: 1139946643

View in Genome Browser
Species Human (GRCh38)
Location 16:70646745-70646767
Sequence CCACGCTGCCGGGCAGATAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139946635_1139946643 -10 Left 1139946635 16:70646732-70646754 CCCCGGCTGTCCTCCACGCTGCC 0: 1
1: 0
2: 1
3: 20
4: 243
Right 1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1139946629_1139946643 13 Left 1139946629 16:70646709-70646731 CCATGGGACTTGCGGCCACCGCC 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1139946634_1139946643 -9 Left 1139946634 16:70646731-70646753 CCCCCGGCTGTCCTCCACGCTGC 0: 1
1: 0
2: 2
3: 14
4: 216
Right 1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1139946631_1139946643 -2 Left 1139946631 16:70646724-70646746 CCACCGCCCCCCGGCTGTCCTCC 0: 1
1: 0
2: 9
3: 71
4: 761
Right 1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1139946632_1139946643 -5 Left 1139946632 16:70646727-70646749 CCGCCCCCCGGCTGTCCTCCACG 0: 1
1: 0
2: 1
3: 27
4: 311
Right 1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1139946627_1139946643 28 Left 1139946627 16:70646694-70646716 CCTGCTTCTGGGCTGCCATGGGA 0: 1
1: 0
2: 0
3: 25
4: 251
Right 1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1139946633_1139946643 -8 Left 1139946633 16:70646730-70646752 CCCCCCGGCTGTCCTCCACGCTG 0: 1
1: 0
2: 1
3: 23
4: 237
Right 1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139946643 Original CRISPR CCACGCTGCCGGGCAGATAA GGG Exonic
900191706 1:1354901-1354923 CCACGCGGTCGCGCAGAAAAAGG + Exonic
900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG + Intronic
914025145 1:143905825-143905847 CCACGGTGCCGGGCCGGTAGCGG + Exonic
914663582 1:149813540-149813562 CCACGGTGCCGGGCCGGTAGCGG + Exonic
915078973 1:153338262-153338284 CCAGGGTGCAGGGCAGATCAGGG - Intronic
1063365439 10:5487597-5487619 CCGCGCTGCCTGGGAGGTAAGGG - Intergenic
1063439620 10:6062081-6062103 CCTGGCTGCCAGGCAGGTAAGGG - Exonic
1067708087 10:48626091-48626113 CCACGCTGCTGGGCCAAAAATGG - Intronic
1071933129 10:90496412-90496434 CCAGGCTGCCGGACAGCTACTGG + Intergenic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1075105820 10:119539372-119539394 CCACCCTGCCGGGCAGGTTTCGG - Intronic
1089992348 11:122873433-122873455 CCACTGTGCCTGGCATATAATGG + Intergenic
1091177615 11:133575817-133575839 CCAGGATGCTGGGCAGAGAAGGG + Intergenic
1091717964 12:2793604-2793626 GCACAGTGCCGGGCACATAACGG + Intergenic
1091807860 12:3368404-3368426 CAACGCTGTCGGTGAGATAAAGG + Intergenic
1096224294 12:49855204-49855226 GCACGATGCCGGGCAGCTAAAGG + Intergenic
1096940214 12:55336161-55336183 CCACCCTGCCTTGCATATAATGG - Intergenic
1102105033 12:110314000-110314022 CCACTGTGCCCGGCCGATAATGG + Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1104688363 12:130805566-130805588 ACACGCTGCCAGGCAGACGAGGG + Intronic
1104939961 12:132390420-132390442 CCACGCTCCCTGGCACAAAAGGG + Intergenic
1105899449 13:24742863-24742885 CCAAGATGCCGGGAAGATGATGG - Intergenic
1106052686 13:26206294-26206316 CCACCCTGCCAGGCAGATGGTGG - Intronic
1112940019 13:104850022-104850044 CCAAGCTTCCAGGGAGATAAGGG + Intergenic
1116051398 14:39807800-39807822 CCAGGCTGGAGTGCAGATAAAGG + Intergenic
1120294380 14:82622175-82622197 CCTCGCTGCGGGGCATATGATGG + Intergenic
1124582999 15:30978494-30978516 CCAAGCTGGCTGGAAGATAAGGG + Intronic
1125653279 15:41334689-41334711 ACACACAGCCAGGCAGATAAAGG - Intronic
1125742946 15:41980041-41980063 CCAGGCAGCAGGGAAGATAAAGG - Intergenic
1129529402 15:76251124-76251146 AGAAGCTGCTGGGCAGATAAAGG + Intronic
1132515454 16:363838-363860 CCGCGGTGTCGGGCAGAGAATGG - Intergenic
1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG + Exonic
1144826621 17:18108880-18108902 CCAGGCTGCAGGGGTGATAAGGG + Intronic
1146599256 17:34200223-34200245 CCACTCCGCCAGGCAGAAAAGGG + Intergenic
1149943150 17:60892631-60892653 CCACCATGCCGGGCCGAAAACGG - Intronic
1151384633 17:73747612-73747634 CCACGCAGCCAGGCAGAAAAAGG - Intergenic
1152762056 17:82113967-82113989 CCAAGCTGCAGGGCAGGCAAGGG - Intronic
1156756596 18:40535563-40535585 CCAGGCTGCCGGGGAGAGCAGGG - Intergenic
1157220753 18:45827201-45827223 CCACCATGCCCGGCAGAGAAAGG + Intronic
1159966823 18:74603009-74603031 CCAGGCAGCCCGGCAGATCATGG + Intronic
1159992563 18:74926893-74926915 CCACGGTGTTAGGCAGATAAAGG - Intronic
1160502695 18:79410241-79410263 CCACGCTGCCGGACAGCTCCGGG - Intronic
1160846997 19:1170437-1170459 CCACACTGCCGGGCGGACAGCGG + Intronic
1161497798 19:4597166-4597188 CCACCGTGCCCGGCAGCTAATGG + Intergenic
1164412893 19:28020565-28020587 CCAGGCTGCCCGGCAAATAGAGG - Intergenic
1165385753 19:35509957-35509979 TCACACTGCCGGGGAGAGAAAGG + Exonic
925903605 2:8525784-8525806 CCACGTTGCTGGGCAGAGAAGGG + Intergenic
926126628 2:10276407-10276429 CCAAGCTGGCGGGCAGGTGACGG + Intergenic
929318277 2:40508109-40508131 GCAAGCTGCTGGGCAGATTAAGG + Intronic
929800515 2:45096339-45096361 CCACCATGCCTGGCAGATCAGGG + Intergenic
931666750 2:64615261-64615283 CCACGCTGCTGGGCTGTGAAAGG + Intergenic
934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG + Intronic
938159722 2:128974244-128974266 CCAAACTGCAGGGCAGGTAAAGG - Intergenic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1175048010 20:56125538-56125560 CCTGGCTGATGGGCAGATAATGG + Intergenic
1175502035 20:59457290-59457312 CCAGGCTGCCTGGCAGCTCACGG + Intergenic
1180226141 21:46393610-46393632 TCAGGCCTCCGGGCAGATAAAGG + Intronic
1182419693 22:30242914-30242936 CCAGGCTGCAGGGAAGATCACGG + Exonic
1182694474 22:32187413-32187435 CCACCCTGCCGGGCTGATGTGGG + Intergenic
1182716825 22:32363694-32363716 CCACCCTGCCGGGCTGATGTGGG - Intronic
1184468405 22:44682226-44682248 CCACAGTGCCGGGCAGATTATGG + Intronic
949323250 3:2835190-2835212 CCACCTCGCCCGGCAGATAAAGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
958999803 3:100950210-100950232 GCACGGTGCCTGGCAGAGAAAGG + Intronic
967105569 3:186252417-186252439 TCAGGCTGCCGGCCAGAAAAGGG - Intronic
970137213 4:12938011-12938033 CTAGGCTGCCTGGCAGACAAAGG - Intergenic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
975657319 4:76654536-76654558 CCAGGCTGCCATGCAGAAAATGG + Intronic
985011714 4:185589043-185589065 ACAGGCTGCAGGGCAGAGAATGG - Intronic
988826754 5:34943972-34943994 CCAAGCTGCCCTGGAGATAATGG - Intronic
990565975 5:57029638-57029660 CCACGGTGCCGGCCAGACCAAGG - Intergenic
1002454983 5:179340875-179340897 CCACGCTGCCCAGGAGATACTGG + Intronic
1005474782 6:26197109-26197131 CCACCGTGCCGGGCCGGTAACGG + Exonic
1009789770 6:68386421-68386443 CCAGGCTGCCAGGCAGAGACTGG + Intergenic
1020007821 7:4791785-4791807 CCAGGGTGCAGGGCAGGTAACGG - Intronic
1026616705 7:71911466-71911488 CTAAGCTGACGGGCAAATAAAGG - Intronic
1030217933 7:107065764-107065786 TCACAGTGCCTGGCAGATAAAGG - Intronic
1032164805 7:129537222-129537244 CCACTGTGCCCGGCAGAGAATGG - Intergenic
1037811365 8:22089109-22089131 CCACGCAGCCGGGCCGGGAAGGG + Intergenic
1041181663 8:55255839-55255861 CAACTCTGCCTGGCAGACAACGG - Intronic
1050162691 9:2734557-2734579 TCATGCTGCAGGGCAGAAAAGGG - Intronic
1060076865 9:120598570-120598592 CCACTGTGCCGGGCCGATCATGG + Intergenic
1195109313 X:101629837-101629859 CCTCGGGGCAGGGCAGATAAGGG - Intergenic
1196076590 X:111584856-111584878 CCACCGTGCCGGGCAAATGAAGG - Intergenic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic