ID: 1139950330

View in Genome Browser
Species Human (GRCh38)
Location 16:70665187-70665209
Sequence CAGGGCTATCAGGGGGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 152}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139950313_1139950330 25 Left 1139950313 16:70665139-70665161 CCACCTATGGCCCGGGGGCCCGT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
1139950319_1139950330 7 Left 1139950319 16:70665157-70665179 CCCGTCACTGTGGCTGAGGCTCA 0: 1
1: 0
2: 1
3: 29
4: 330
Right 1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
1139950320_1139950330 6 Left 1139950320 16:70665158-70665180 CCGTCACTGTGGCTGAGGCTCAG 0: 1
1: 0
2: 3
3: 25
4: 307
Right 1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
1139950312_1139950330 29 Left 1139950312 16:70665135-70665157 CCTACCACCTATGGCCCGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
1139950317_1139950330 14 Left 1139950317 16:70665150-70665172 CCGGGGGCCCGTCACTGTGGCTG 0: 1
1: 0
2: 1
3: 33
4: 458
Right 1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
1139950314_1139950330 22 Left 1139950314 16:70665142-70665164 CCTATGGCCCGGGGGCCCGTCAC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
1139950316_1139950330 15 Left 1139950316 16:70665149-70665171 CCCGGGGGCCCGTCACTGTGGCT 0: 1
1: 0
2: 1
3: 55
4: 459
Right 1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
1139950310_1139950330 30 Left 1139950310 16:70665134-70665156 CCCTACCACCTATGGCCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139950330 Original CRISPR CAGGGCTATCAGGGGGTCTC TGG Intronic
900105796 1:980510-980532 CAGGGCTATCGGGGGGCCTCTGG + Exonic
900366418 1:2313649-2313671 CAGGGCTGTCAGGGAGAATCTGG - Intergenic
900793095 1:4692262-4692284 CAGGGTTGTCAGGGCTTCTCGGG + Intronic
902758952 1:18568314-18568336 CATGGCTATCAGGCTGTTTCTGG - Intergenic
903231971 1:21927501-21927523 CAGGGCTAGGATGGGGTCCCAGG + Intronic
905168673 1:36098081-36098103 CAGGGGCACCAGGGGGTCCCGGG + Exonic
905259109 1:36705207-36705229 CAGGGCTATCAGGAAATGTCAGG - Intergenic
907278015 1:53327674-53327696 CGGGGCTATCGGGGGCTCCCGGG - Intronic
907407093 1:54260348-54260370 CAGGGCGAGCAGTGGGGCTCTGG + Intronic
910586989 1:88891300-88891322 CAGGACTGTCAGGGTGTCGCAGG - Intronic
913182061 1:116331624-116331646 CAGGCCTACCATTGGGTCTCTGG + Intergenic
916371297 1:164098191-164098213 CAGGGATCTCAGGGAGTCTCTGG - Intergenic
920192156 1:204200725-204200747 CAGGCTAATCAGGGGGTTTCAGG + Intronic
921235560 1:213124125-213124147 CAGGGCTATTAGAGGGCCCCAGG - Intronic
1062836252 10:637822-637844 CAGGGCACTCAGCGGGTCTTGGG - Intronic
1062982466 10:1736972-1736994 CCGGCCTCTCATGGGGTCTCCGG - Intronic
1068659838 10:59612549-59612571 CAGGGCAATCATGAAGTCTCTGG + Intergenic
1069075883 10:64037957-64037979 CAGGGCTATGACTGAGTCTCGGG - Intergenic
1071208599 10:83312732-83312754 CAGGGCTGGCAGGGGGCCACTGG - Intergenic
1073054310 10:100689250-100689272 CAGGGCTATGAGGGGGGCACAGG + Intergenic
1073778226 10:106809441-106809463 CAGGGCTAGCAGGGGGATCCTGG - Intronic
1076060901 10:127413317-127413339 CAGGGCCATTAGGGGATTTCAGG - Intronic
1076482747 10:130795614-130795636 CAGGGCTACCAGGGAGTGCCAGG - Intergenic
1076810782 10:132885425-132885447 CGGGGCTACGCGGGGGTCTCGGG + Intronic
1082240331 11:49862931-49862953 CGAGGCTATCAGGGAGTCCCTGG - Intergenic
1084199148 11:67543699-67543721 CAGGGCTAGGAAGGGTTCTCAGG - Intergenic
1085035234 11:73295979-73296001 CAGGGCTGCCAGGGGCTCACTGG - Intronic
1085408244 11:76276832-76276854 CAGCCCTGGCAGGGGGTCTCTGG + Intergenic
1086680266 11:89662645-89662667 CCAGGCTATCAGGGAGTCCCTGG - Intergenic
1089494431 11:118901191-118901213 CAGGGCCAGCAGGGATTCTCTGG - Exonic
1092078543 12:5693642-5693664 CAGGGTATTGAGGGGGTCTCTGG - Intronic
1092872023 12:12813643-12813665 TAGGGCAAATAGGGGGTCTCAGG - Intronic
1096601897 12:52735570-52735592 CTGGGATCCCAGGGGGTCTCAGG + Intergenic
1102428449 12:112862874-112862896 CAGGGCTACCAGGGGCCCTCTGG + Intronic
1111676937 13:91399213-91399235 AGGGGCAATGAGGGGGTCTCTGG + Intronic
1115437652 14:33393753-33393775 CAGTGCTCTCAGGGGATCTCTGG + Intronic
1118758184 14:68860727-68860749 CAGGGTTGTCAGAGGGTCCCAGG - Intergenic
1122789740 14:104179169-104179191 CAGGGCTGCTTGGGGGTCTCTGG + Intronic
1122884290 14:104703704-104703726 CAGGGCTAGAACGAGGTCTCAGG - Intronic
1124661042 15:31551203-31551225 CTGGGCCATGATGGGGTCTCCGG - Intronic
1124785193 15:32672557-32672579 CAGGTCACTCAGGGGATCTCCGG - Intronic
1125191698 15:37001124-37001146 CAGGGCTATACTGGGGGCTCAGG + Intronic
1132775845 16:1593570-1593592 CTGGGCTATGACAGGGTCTCAGG + Intronic
1134809383 16:17154320-17154342 CAGGGCTAACATGGGGGCCCTGG + Intronic
1138166919 16:54811178-54811200 CAGGGCTATGAGCAGATCTCAGG - Intergenic
1138249742 16:55492783-55492805 CAGGGCGGTCAGGGGGCCGCTGG - Intronic
1139322500 16:66126816-66126838 CAAGGCTATCTGGGGTCCTCTGG + Intergenic
1139732666 16:68959957-68959979 CAGGGCTTTCAGGAGGTGTGAGG + Intronic
1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG + Intronic
1140407983 16:74723670-74723692 CAGAGGTATCAGGGTTTCTCTGG - Intronic
1141203644 16:81915781-81915803 CAGGGCAGGCAGGGGGGCTCTGG - Intronic
1141892766 16:86938129-86938151 CAGGGCTTTCAGGGTGGCTCTGG + Intergenic
1144738825 17:17569860-17569882 CAGGGCAAGCAGGGGGGCTCTGG + Intronic
1145005113 17:19333182-19333204 CAGGGCCTTCAAGGGCTCTCTGG - Intronic
1146555653 17:33821477-33821499 CAGGGCTTTCAGGGCCTTTCTGG - Intronic
1147248748 17:39139752-39139774 CAGGGCTCTCTCGGGCTCTCCGG + Exonic
1148110888 17:45144261-45144283 CAGGGCCATCAGGGGGGCATTGG - Intergenic
1148326370 17:46785658-46785680 CCGGGCTCTCAGGTGGTCCCTGG - Intronic
1149798950 17:59548522-59548544 CAGATCTATGTGGGGGTCTCAGG + Intergenic
1152676763 17:81645258-81645280 CCTGGCTGTCAAGGGGTCTCTGG + Exonic
1152700411 17:81815681-81815703 GAGGGCTGTCAGGAGGTCCCAGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1157424321 18:47571884-47571906 CAGGGGACTCAGGGGGACTCAGG - Intergenic
1159832262 18:73291871-73291893 GAGGGCTTTCAGGTGGTCTCTGG - Intergenic
1160263998 18:77322854-77322876 CAGGGCTGTCACGGGGAGTCTGG + Intergenic
1160537495 18:79602936-79602958 CAGGACTGTCAGGGGGCTTCCGG + Intergenic
1161643148 19:5436606-5436628 CGGGGCTGTGAGGGGGTCTTTGG - Intergenic
1161764514 19:6199262-6199284 TAGGTCCATCTGGGGGTCTCCGG + Intronic
1162808209 19:13149990-13150012 CAGGGGTATATAGGGGTCTCCGG - Intronic
1163114579 19:15181225-15181247 CAGCGCTAACAGCGGGACTCAGG - Intronic
1163152126 19:15421881-15421903 CATGGCTGGGAGGGGGTCTCTGG - Exonic
1163329440 19:16627513-16627535 GAGGGCTTCCCGGGGGTCTCGGG + Intronic
1164507603 19:28872340-28872362 CAGGGCTTCCAGGGGCCCTCAGG + Intergenic
1165230683 19:34384676-34384698 CAGGTCTCTCAGGAGGTCTGAGG + Intronic
1166203336 19:41252824-41252846 CAGGGCTACCTGGGGGGCTCAGG + Exonic
1166297987 19:41897942-41897964 CCAGGCTATCAGGGCGTCTGGGG + Intronic
1166570617 19:43794214-43794236 AAGGGCTATGAGGGAGGCTCTGG + Intergenic
1166920459 19:46225915-46225937 CAGTGCTATCAGGAGGTAACAGG + Intergenic
1167460459 19:49621762-49621784 CAGGACTGTCAGGAGATCTCTGG + Intronic
1167637258 19:50662253-50662275 CGGGGATATCCGGGGGGCTCGGG - Exonic
925461623 2:4068085-4068107 AGGGCCTATCAGGGGGTCGCGGG - Intergenic
926887568 2:17612255-17612277 CATGGCTATCAGGCAGCCTCTGG - Intronic
932777967 2:74539755-74539777 CAGGGCGAGCAGGAGGTCCCGGG + Intronic
937247232 2:120501663-120501685 CAGGAGTTTCAGGGGGTCCCAGG - Intergenic
937641263 2:124214331-124214353 CAGGGCTAACAAGAGGGCTCTGG - Intronic
941503226 2:166307951-166307973 TAGGGTTATCAGTGGGTTTCTGG + Intronic
941843398 2:170110958-170110980 CAGGGCTGTCAGGGGGGGTGTGG - Intergenic
944582964 2:201148786-201148808 CAGTGCTATCAGGGGCTATCTGG - Intronic
948668032 2:239548447-239548469 CATGGCTACCATGGGCTCTCAGG + Intergenic
1171245692 20:23608083-23608105 CAGGGCTATCCCCAGGTCTCAGG + Intergenic
1172129459 20:32646005-32646027 CAGTGCTATCAGAGAGTCCCTGG + Intergenic
1172168597 20:32914556-32914578 CATGGCTAGGAGGGGGCCTCAGG + Intronic
1172657721 20:36547119-36547141 CAGGGCTGTCATGAAGTCTCAGG - Intronic
1175937802 20:62522913-62522935 CAGGGCTATCAGCGTGGCTGGGG + Intergenic
1176135431 20:63520288-63520310 CAGAGCTGTGAGGGGGACTCGGG + Intergenic
1176516628 21:7789198-7789220 CTTGACTCTCAGGGGGTCTCTGG + Intergenic
1177424182 21:20901297-20901319 GAGGCCTGTCAGGGGGTCTTGGG + Intergenic
1178551396 21:33542659-33542681 CACGGCTTTCAGGCGCTCTCAGG - Exonic
1178650656 21:34419210-34419232 CTTGACTCTCAGGGGGTCTCTGG + Exonic
1179410787 21:41161588-41161610 CTGGGCTGTCAAGGGGTCACAGG + Intergenic
1179574743 21:42301103-42301125 CAGGGCTAGCAGGAGGGCACTGG + Intergenic
1180855852 22:19044253-19044275 CAGCCCTATCAAGGGGCCTCTGG - Intronic
1183521395 22:38297955-38297977 CCGGCCTATCTGGGGGGCTCTGG + Intronic
1184242888 22:43220726-43220748 CAGGGCTGGCTCGGGGTCTCAGG + Intronic
1185068475 22:48643659-48643681 CAGGGCTAGCAGGCTTTCTCAGG + Intronic
949726323 3:7050096-7050118 CAAGGCTATGAGGAGGTCTGTGG + Intronic
950135423 3:10577472-10577494 CAAGGCCATCAGGGGATCCCAGG + Intronic
950475695 3:13213736-13213758 CAGGGATATGAGTGGGTCCCAGG + Intergenic
950942647 3:16909052-16909074 CATGGTTATCAGTGTGTCTCAGG + Intronic
952924765 3:38312934-38312956 GAGGGCCAGCAGGGGGTCTCTGG + Intronic
954217682 3:49133488-49133510 CAGGGCTGTGGGGGGCTCTCGGG + Intergenic
954613137 3:51956642-51956664 CAGGGCCCTCTGGGGGTCTCTGG - Exonic
954954932 3:54510638-54510660 CAGAGCTATCAAGGAGTCTTTGG + Intronic
957219580 3:77364522-77364544 CAGGCATATCAGAGGTTCTCTGG + Intronic
957681374 3:83440111-83440133 CAGGGCTATCAGATGGTAGCAGG - Intergenic
961282564 3:125775440-125775462 CAGGGCTCTCAGGGGCCCTGGGG - Intergenic
961593232 3:127996390-127996412 CAGGGATCCCAGGGGGGCTCAGG + Intergenic
963587102 3:147205824-147205846 GAGGCCTATCAGGGGGTGTCGGG - Intergenic
966224742 3:177585869-177585891 CAGGGATATCACTGGTTCTCAGG - Intergenic
966826848 3:183972074-183972096 CAGGCCCATCAAGGGGTCACGGG + Intronic
969559087 4:7934558-7934580 CTGGGATATCAGGGGCACTCAGG + Intronic
969675665 4:8613052-8613074 CAGGGCTATGACGGGGGCTGAGG - Intronic
969708689 4:8830494-8830516 CAGGGGTGTCAGGGGCACTCTGG + Intergenic
969999998 4:11355447-11355469 CAGGGCCATCAAGGCGTCTGAGG + Intergenic
972867754 4:43255695-43255717 CAGGCCTATCTAAGGGTCTCTGG + Intergenic
982225996 4:153166990-153167012 CAGGGCTGTCAGGGTGTGTGTGG + Intronic
987544615 5:19297213-19297235 CAGGGATATCAGGGGGTTCAGGG - Intergenic
992760179 5:79944377-79944399 CAGGGCGACCAGGGGTTCCCAGG + Intergenic
993991275 5:94661005-94661027 CAGGAATATCAGTGGGGCTCCGG + Intronic
998164700 5:139836375-139836397 CAGGGCTCTCATGGGGGCCCAGG + Intronic
1002814741 6:669270-669292 CAGGGCTGGCAGGGGGCCACAGG - Intronic
1002858253 6:1056803-1056825 CAGAGCTAACACAGGGTCTCTGG - Intergenic
1004009044 6:11663764-11663786 CAGGCCTGTCAGAGGTTCTCCGG + Intergenic
1004187164 6:13430740-13430762 CAGGGCTATCTGTGGGTCTTGGG + Intronic
1006348704 6:33504569-33504591 CAGGGATATCATAGAGTCTCTGG - Intergenic
1006509755 6:34515530-34515552 CAGGGCCAGCAGGGAGGCTCTGG - Intronic
1008131055 6:47720512-47720534 CAGGTCTGTCAGGTGGTCCCAGG + Intronic
1013821051 6:114153946-114153968 AAGGGTTATCAAGGGGGCTCAGG + Intronic
1018369662 6:163156163-163156185 CAGGGCTGTCAGCCAGTCTCTGG + Intronic
1018779903 6:167053761-167053783 CAGGGCTCTCAGGGTGTTTCAGG + Intergenic
1019550070 7:1597763-1597785 CAGAGCTTCCAGGGGGTCTGTGG + Intergenic
1019569021 7:1700151-1700173 CAGGGCTGTGAGGGGATGTCGGG - Intronic
1019732384 7:2635132-2635154 CAGGGCCACCAGGGAGTCTCAGG - Intronic
1022379319 7:29844823-29844845 CAGGGCTATTATTGGGACTCTGG + Intronic
1023013581 7:35944045-35944067 GAGGGCTGTCAGGGGGTCCTAGG + Intergenic
1023037687 7:36147571-36147593 CAGGGCTAGCAGGGGACCACGGG + Intergenic
1024549713 7:50552563-50552585 CAGGTCAATCAGGAGGTCTGAGG - Intronic
1029557245 7:101278914-101278936 GGGGGCTGTCAGGGGGCCTCAGG + Intergenic
1032195552 7:129786344-129786366 GAGGGTTATCATGGGGTCCCTGG + Intergenic
1032475751 7:132210571-132210593 CAGGGCTTTCAGAGCTTCTCAGG + Intronic
1035308188 7:157946880-157946902 CATGCCTCTCAGAGGGTCTCCGG - Intronic
1035367489 7:158358396-158358418 CTGGGCTTTCAGTGTGTCTCTGG - Intronic
1035468839 7:159097027-159097049 CAGGCCGCTCTGGGGGTCTCTGG + Intronic
1035721440 8:1796385-1796407 GAGGACTATCAGGGAGGCTCGGG - Intergenic
1040304494 8:46205028-46205050 CAGGGTTGTAAGGGGGCCTCGGG + Intergenic
1044867955 8:96590877-96590899 CAGGGCTCCCGGGTGGTCTCTGG - Intronic
1049598829 8:143497869-143497891 CAGGGCTTTCTGGGGCTCCCCGG + Intronic
1052930662 9:34052808-34052830 CAGAGCTAACACGTGGTCTCTGG - Intergenic
1060946804 9:127574531-127574553 CAGGACTAGCAAGGGGTCTTGGG - Intronic
1061911734 9:133728596-133728618 AAGGGCTCTGATGGGGTCTCAGG - Intronic
1062287406 9:135779233-135779255 CATGGCTGTGGGGGGGTCTCAGG - Intronic
1062732882 9:138119460-138119482 CAGGGCTGGCACGGGGGCTCCGG - Intronic
1186604673 X:11077737-11077759 AAGGGCAAGCAGTGGGTCTCGGG + Intergenic
1189412744 X:40788355-40788377 AAATGCTATGAGGGGGTCTCTGG + Intergenic
1191645091 X:63471290-63471312 CAGGGTGATCAGAGGTTCTCTGG + Intergenic
1196772665 X:119310303-119310325 TAGGGATATCAGGGATTCTCTGG - Intergenic
1199549309 X:149041077-149041099 CAAGGCTTTCAGTGGGTTTCTGG - Intergenic
1200141651 X:153905598-153905620 CCGGGCTAGCAGCGGGTCCCGGG - Exonic
1201313102 Y:12615311-12615333 CAGGCCTCTCAGGGGGTCAGAGG + Intergenic