ID: 1139951288

View in Genome Browser
Species Human (GRCh38)
Location 16:70672392-70672414
Sequence TAGGGTCCTGAATTGGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139951284_1139951288 -8 Left 1139951284 16:70672377-70672399 CCCGGGAACATTATGTAGGGTCC 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1139951288 16:70672392-70672414 TAGGGTCCTGAATTGGGTCATGG 0: 1
1: 0
2: 0
3: 9
4: 146
1139951285_1139951288 -9 Left 1139951285 16:70672378-70672400 CCGGGAACATTATGTAGGGTCCT 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1139951288 16:70672392-70672414 TAGGGTCCTGAATTGGGTCATGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139951288 Original CRISPR TAGGGTCCTGAATTGGGTCA TGG Intronic
904205903 1:28855211-28855233 TAGAGTCCTGAATTAAGTGATGG + Intronic
904948895 1:34219987-34220009 TAGGGTCCAGCATTGGGGAAGGG - Intergenic
910086790 1:83412495-83412517 TAGGGTTGTGAATTGGGGAAGGG + Intergenic
913202277 1:116504596-116504618 TAGGGCCCTGAGCTGGGGCAGGG - Intergenic
915585701 1:156842730-156842752 TAGAGTCCTGATTGGGCTCAAGG - Intronic
915908887 1:159900047-159900069 TTGTGTCCTGAATTGGGTGGGGG - Intronic
917802228 1:178581309-178581331 CTGAGTCCTGAATTGGGTCCCGG - Intergenic
918200733 1:182264169-182264191 TGGGGTCCTGAGGTGGCTCAGGG - Intergenic
924517582 1:244779515-244779537 TAGGGTCCTGCAGTGGGGCCGGG + Intergenic
1064178964 10:13099137-13099159 GAGGGCCCGGAATTGGGTCTGGG + Intronic
1065902249 10:30219173-30219195 TAGGATCCTGAATTGGACAAAGG + Intergenic
1068160506 10:53256624-53256646 TTGAGTCCAGAATTAGGTCAAGG - Intergenic
1069562783 10:69442347-69442369 TAGGGTCCTGCATGGGGTGATGG - Intergenic
1069862349 10:71479655-71479677 TTGGGTCATGACTTGGGTGAGGG + Intronic
1070817657 10:79335513-79335535 TAGGGTCTTGAGGTGGGGCATGG + Intergenic
1074158667 10:110819514-110819536 GAGGGTCCTGATTTGGGGGAAGG + Intronic
1075227539 10:120643261-120643283 TAGAGTCCTGAATTGGTGCAGGG - Intergenic
1075634616 10:124022087-124022109 GAGGAGCCTGAAGTGGGTCAAGG - Intronic
1075792194 10:125092954-125092976 TTGGGTCCTGAGATGGGCCATGG - Intronic
1075874407 10:125794565-125794587 TAAAGTCCTGAATTAGCTCAGGG - Intronic
1076262986 10:129085270-129085292 TAGGGGCCTGAAATGAGTGAAGG + Intergenic
1076750330 10:132539000-132539022 CAGGGTCCAGAATTGGGTTTGGG - Intronic
1077088260 11:765446-765468 CAGGTTCCTGCATGGGGTCATGG + Intergenic
1083365800 11:62140851-62140873 CAGGGTACTGAAGGGGGTCAGGG - Intronic
1083672254 11:64305965-64305987 GCGGGTCCTGACTCGGGTCAGGG + Intronic
1087453866 11:98358139-98358161 TTGGTTCCTGACTTGGTTCAAGG + Intergenic
1088549655 11:110999614-110999636 TGGGATCCTGAATTGGATCATGG - Intergenic
1090347608 11:126083845-126083867 GAAGGTCCTGGATTGAGTCAGGG - Intergenic
1091344275 11:134842505-134842527 GAGGGTCCCGAATAGGGTCCTGG + Intergenic
1092730989 12:11534335-11534357 TGGGATCCTGAATTGGATCCTGG - Intergenic
1095555928 12:43504541-43504563 TAGGGTCCAGTAATTGGTCATGG - Intronic
1096835421 12:54347685-54347707 TAGGTTCCTCAATTGAGACAAGG + Intronic
1099915313 12:88885448-88885470 TGGTGTCCTGAATTGGATCCTGG + Intergenic
1100157638 12:91819461-91819483 TAAGGTCCTGAAAAGGGTGAAGG + Intergenic
1101106619 12:101446622-101446644 TATGGTCTTGAATTGGATCCTGG + Intergenic
1102445635 12:113000167-113000189 TAGTCTCCTGAATTTGATCATGG - Intronic
1103996245 12:124832010-124832032 TGGGGCCCTGGATTGGGTCCTGG + Intronic
1104094562 12:125545142-125545164 CAGGCTGCTGAACTGGGTCAAGG + Intronic
1106950021 13:34872953-34872975 CAGAGTCCTGAAGTGGTTCAGGG + Intergenic
1109038178 13:57293702-57293724 CAGGCTCCTGAATTAGGACATGG + Intergenic
1113842803 13:113369952-113369974 GAGGGTCCTGAATAGGGGCTGGG - Intergenic
1114580518 14:23754393-23754415 TGTGGTCCTGGATTGGGTCTTGG + Intergenic
1120698691 14:87673808-87673830 TAGTGTCCTGAATGGGATCCTGG - Intergenic
1123053608 14:105559385-105559407 AAGGGTCCTGACCAGGGTCAGGG + Intergenic
1123078187 14:105679800-105679822 AAGGGTCCTGACCAGGGTCAGGG + Intergenic
1125475226 15:40043401-40043423 TAGGGTCAGGAATTTGGTTAGGG + Intergenic
1125725784 15:41867467-41867489 GAGAGTCCTGAAGGGGGTCACGG - Intronic
1125844923 15:42843353-42843375 TAGGGGCCTGAATTCTGTTAAGG + Intronic
1129969825 15:79768500-79768522 TGAGGGCCTGATTTGGGTCATGG - Intergenic
1137599551 16:49746943-49746965 TAGTGTCCCCACTTGGGTCATGG - Intronic
1137996227 16:53217069-53217091 TAGGATCCTGAATTGGATCCTGG - Intronic
1139951288 16:70672392-70672414 TAGGGTCCTGAATTGGGTCATGG + Intronic
1140294840 16:73698799-73698821 TAGGGTCCTGCACTGGGTTCTGG + Intergenic
1140713370 16:77698798-77698820 GAGAATCTTGAATTGGGTCATGG + Intergenic
1141027564 16:80562590-80562612 TAGGGTCTTGATTTGGGTGTTGG - Intergenic
1141307649 16:82881439-82881461 AATGGTCCTGAGTTGGGGCAAGG + Intronic
1142814941 17:2418032-2418054 CACGGTCCTGAATTGAGTCTTGG + Exonic
1145366200 17:22268694-22268716 TAGGGTCCCGCAATGGGTTATGG + Intergenic
1151805793 17:76404522-76404544 TGTGTTCCTGAATTGGGTCCTGG + Intronic
1152988124 18:337866-337888 TAGGGTCATGACCAGGGTCAGGG - Intronic
1153082663 18:1246966-1246988 TAGGGTGACGAACTGGGTCAGGG + Intergenic
1154191061 18:12231486-12231508 CAGAGTCCTGAACTGGGTGAGGG + Intergenic
1155372536 18:25117129-25117151 TATGGTTCAGAATTTGGTCAGGG + Intronic
1157093555 18:44664272-44664294 AAGGGTTCTGAATGGAGTCATGG - Intergenic
1159278485 18:66251794-66251816 TAGGGTACTGGATTGGGAGAAGG - Intergenic
1163337514 19:16682929-16682951 TGGGATCCTGCATTGGGTCTTGG - Intronic
1165006781 19:32813924-32813946 TTGGGTCATGAATTGGGTTGTGG + Intronic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1166870335 19:45866822-45866844 TGGGGTCCTGGGTTGGGTCTGGG + Intronic
927678674 2:25125473-25125495 CAGGGTCTTGAATGTGGTCAGGG + Intronic
928884708 2:36135044-36135066 TAGGATCCTGGATTGGGTTCTGG - Intergenic
931318548 2:61154409-61154431 TAGTGTCCTGAATGGGGTCCTGG + Intronic
934096361 2:88609388-88609410 TTGGTTCCTGAATTGTGCCAAGG - Intronic
943721473 2:191207320-191207342 TAAGATCCTAAATTGGCTCATGG + Intergenic
946318968 2:218937537-218937559 TGGGATCCTGGATTGGTTCAAGG + Intergenic
946956715 2:224938665-224938687 AAGGGTCCTGGATTAAGTCAAGG - Intronic
1169934846 20:10872186-10872208 TAGTTTCCTAAAATGGGTCATGG - Intergenic
1170060948 20:12258583-12258605 CAGAGTCCTGAAGTGGTTCAGGG + Intergenic
1174678060 20:52377409-52377431 TTGGGTCCTGGGTTGGGTCTTGG + Intergenic
1174678068 20:52377433-52377455 TTGGGTCCTGGGTTGGGTCTTGG + Intergenic
1174678190 20:52377847-52377869 TTGGGTCCTGGGTTGGGTCTTGG + Intergenic
1178479329 21:32966116-32966138 TGGAGTCCTGGATTGGGTCTTGG - Intergenic
1178954539 21:37010570-37010592 TAGGGGCATGAAGTGGGTGAGGG - Intronic
1182561652 22:31164498-31164520 TAGGATCCAGGATTGGGTCCTGG - Intronic
1183828333 22:40405318-40405340 TAGGGTCCTGGAGGGGGTCCTGG - Intronic
1185430477 22:50807811-50807833 TAGGGTTCTGGTTTGGGTTAGGG + Intergenic
949482486 3:4506903-4506925 TAGGGTCCTGAATTGTTTTTAGG - Intronic
952439182 3:33307439-33307461 TATGATCCTGAATTGGATCCTGG + Intronic
952995133 3:38872497-38872519 TGGGGTGCTGAATTGGATCCTGG + Intronic
953722935 3:45372190-45372212 AATGGCCCAGAATTGGGTCAAGG + Intergenic
956335752 3:68161465-68161487 TAGGGCCCAGAATTTGGTGATGG + Intronic
960438464 3:117656735-117656757 TGGGATCCTGAATTAGATCATGG - Intergenic
962474163 3:135741093-135741115 TAGAGGGCTGGATTGGGTCATGG + Intergenic
964003551 3:151805975-151805997 TAGGGTGTAGAACTGGGTCAAGG - Intergenic
964425477 3:156548582-156548604 CAGGGTCCTGAATTAGTACATGG - Intronic
968538457 4:1149985-1150007 GAGGCTCCTGACTTGGGTGAGGG + Intergenic
974319892 4:60333869-60333891 TAGTTTCCTGAATTGGGCCCAGG + Intergenic
978868912 4:113550736-113550758 TAGGGTCCTGAAAGGGGCCATGG - Intronic
979681548 4:123465695-123465717 TAAGGTCCTGATTAGGGTGAAGG + Intergenic
979882771 4:125983346-125983368 TAGGATCTTGAATTGGATCTTGG + Intergenic
979995069 4:127422161-127422183 TATGGTCCTCAATTGGCCCATGG + Intergenic
980264947 4:130503267-130503289 TAGGGGACTGATTTGGGGCAGGG + Intergenic
981188166 4:141830029-141830051 CAGGGTCCTGAAGAGGATCAGGG - Intergenic
984244581 4:177259677-177259699 TTGGTTCCTGAATTGGCTCTTGG + Intergenic
985800580 5:2003301-2003323 GAGGGTCCTGAGTTGGATCGGGG - Intergenic
986841940 5:11707466-11707488 TAGGGTCCTGAATTTGTTTGAGG - Intronic
987032106 5:13985827-13985849 TAGGGAGCTGAGTCGGGTCAGGG - Intergenic
989186563 5:38632006-38632028 TAGAGTCCTGTCTTGGGGCAGGG - Intergenic
992982602 5:82191978-82192000 TAGGGGCCTGAATTTGGTTCAGG + Intronic
996863382 5:128089955-128089977 TAGTGTCCAGAACTGGGTAAAGG + Intronic
997226433 5:132212777-132212799 GAGTGTCCTGAATAGGGTTATGG - Intronic
1000362512 5:160461117-160461139 TATTGGCCTGAATTGGGTCTTGG + Intergenic
1000460236 5:161507220-161507242 TAGGGTACTGGATTGGATCCTGG + Intronic
1001211540 5:169814449-169814471 TGGGATCCTGAATTGAATCATGG + Intronic
1004619243 6:17319032-17319054 TAGGGTGTAGAACTGGGTCAGGG + Intergenic
1006646532 6:35518601-35518623 AAGTGTCCAGATTTGGGTCAGGG + Intergenic
1010993962 6:82512283-82512305 TAGGCTACTGAGTTGGGACATGG - Intergenic
1011258474 6:85448608-85448630 TGGTATCCTGAATTGGGTCCTGG + Intergenic
1012557840 6:100537424-100537446 TGGGATCTTGAATTGGATCATGG + Intronic
1013826210 6:114214339-114214361 TGGGATCCTGAATTGGCTCCTGG - Intronic
1016367255 6:143332893-143332915 TGGGGTCCTGGATTGGATCCTGG + Intronic
1017202294 6:151768457-151768479 TATAATCCTGAATTGGGTCTTGG + Intronic
1017254052 6:152313382-152313404 TAGGGGCCTGAATAGGGGCTGGG - Intronic
1019265892 7:117466-117488 TAGAGCCCCGACTTGGGTCATGG + Intergenic
1020719272 7:11721173-11721195 AGGAATCCTGAATTGGGTCATGG + Intronic
1022276820 7:28863309-28863331 TGGGGTCCTGGATTGGATCCTGG + Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029664551 7:101986759-101986781 TAGGGTCCGGAGTTGGGCCCTGG - Intronic
1036073265 8:5465824-5465846 TGGGGTCCTAAATTGGATCCTGG + Intergenic
1036102579 8:5802921-5802943 TAGGTTCCTTAATTGGGCCTCGG + Intergenic
1038993572 8:32896478-32896500 TAGGATCCTGGATTGGATCCTGG + Intergenic
1041795309 8:61741345-61741367 TAGTGTCCTGAATAGGATCCTGG - Intergenic
1041821728 8:62043359-62043381 TAGGGTCCTGAATTTGATCCAGG - Intergenic
1043543412 8:81288652-81288674 GAGGGTCCTGAATCTGGTGAGGG + Intergenic
1045177986 8:99746854-99746876 AATGGTCCAGAATTGGGGCAAGG - Intronic
1047833407 8:128660893-128660915 TATGATCCTGAATTAGGTCCTGG + Intergenic
1048253592 8:132887599-132887621 TACTGTACTGCATTGGGTCAGGG - Intronic
1059902711 9:118945846-118945868 CAGGGTCCTGACTTGGCTCTTGG + Intergenic
1060110533 9:120903608-120903630 TAGGGTCCTGACTTGTCTCAGGG + Exonic
1060433757 9:123574945-123574967 TAGGATCCTGGATTGGATCTTGG - Intronic
1060799359 9:126533933-126533955 CAGGGTCCGTAAGTGGGTCAAGG + Intergenic
1061493970 9:130961249-130961271 TGAGGACCTGCATTGGGTCAAGG - Intergenic
1061953450 9:133949286-133949308 AAGGCACCGGAATTGGGTCAGGG - Intronic
1185524913 X:770234-770256 TGGGGTCCTGAACTGGTTCATGG + Intergenic
1186387822 X:9127749-9127771 CAGAGTCCTGAATTGGCACAGGG - Intronic
1186546793 X:10458378-10458400 TGGGATCCTGGATTGGGTCCCGG + Intronic
1186766611 X:12776935-12776957 TAGGATCCTGGATTGGATCCTGG + Intergenic
1187703940 X:21990923-21990945 TAGGGTCCTGCAGTGGGATATGG - Intronic
1188263153 X:28040887-28040909 TAGGGTACTGACTTAGGACAGGG - Intergenic
1188992253 X:36836070-36836092 TAGGCTCATGAATTAGGTTATGG + Intergenic
1189549446 X:42077821-42077843 CAGTGTCCTGAAGTGGCTCAGGG + Intergenic
1189630120 X:42943691-42943713 TAGGGTGTAGAACTGGGTCAAGG + Intergenic
1197155495 X:123265824-123265846 CAGGGTCCTGAAAGGGTTCAGGG - Intronic
1198603970 X:138315980-138316002 TAGGATCCTGGATTGGCTCTTGG - Intergenic
1199416014 X:147584032-147584054 TAGAGGCCTGCAGTGGGTCATGG - Intergenic
1200929388 Y:8683492-8683514 TAGCGTCCTGCAGTGGGTAATGG - Intergenic