ID: 1139951390

View in Genome Browser
Species Human (GRCh38)
Location 16:70673361-70673383
Sequence GCTGACCTTCCAACCAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139951387_1139951390 24 Left 1139951387 16:70673314-70673336 CCAGAGAGAGACTCAGATTCCTC 0: 1
1: 0
2: 4
3: 17
4: 272
Right 1139951390 16:70673361-70673383 GCTGACCTTCCAACCAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 70
1139951388_1139951390 5 Left 1139951388 16:70673333-70673355 CCTCAGAAAGAAGCATCAGTGAC 0: 1
1: 0
2: 3
3: 18
4: 246
Right 1139951390 16:70673361-70673383 GCTGACCTTCCAACCAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 70
1139951386_1139951390 25 Left 1139951386 16:70673313-70673335 CCCAGAGAGAGACTCAGATTCCT 0: 1
1: 0
2: 2
3: 54
4: 958
Right 1139951390 16:70673361-70673383 GCTGACCTTCCAACCAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139951390 Original CRISPR GCTGACCTTCCAACCAATGG TGG Intronic
902308472 1:15561991-15562013 GCTGACATTTCAACTAAGGGAGG - Intronic
908748217 1:67395874-67395896 GGTGACCTTCCCACCCATGATGG + Exonic
915638202 1:157200927-157200949 GCTGCGTTTCCAACCATTGGTGG + Intergenic
916675813 1:167063654-167063676 GCTGACCTGCCAATCAAAGGAGG - Exonic
919556846 1:199066652-199066674 ACTGATCACCCAACCAATGGTGG - Intergenic
919918515 1:202153928-202153950 GCTGACCTCCCATCCAGTAGGGG - Intronic
1065489969 10:26272890-26272912 GCTGAACTTACAACAAAAGGTGG + Intronic
1069839269 10:71328948-71328970 GCTGACCTCCCAATCCAAGGAGG + Intronic
1077572715 11:3353665-3353687 GCACACCTTCCAACCAAAGCAGG - Intronic
1081661800 11:44892956-44892978 GCTGCTCTTCCCACCAATTGAGG - Intronic
1081855081 11:46297806-46297828 GCTGAGCTTGGAACCAATGGTGG - Intronic
1083901333 11:65644954-65644976 GCTGAGCTTCCAACGCAAGGTGG + Exonic
1087743161 11:101912773-101912795 GCTGACCTTCCATCCCATTATGG - Intronic
1090438011 11:126702920-126702942 GCTGACCTTGCAAGGAATGGAGG - Intronic
1102742215 12:115217841-115217863 CATGGCCTTCCAACAAATGGAGG + Intergenic
1107297456 13:38925903-38925925 CCTGAGCTTCCACACAATGGGGG + Intergenic
1111658890 13:91184629-91184651 GCTTACTTGCCAAACAATGGGGG - Intergenic
1113475188 13:110575706-110575728 ACTGACCTGCTAACCAATGAAGG - Intergenic
1115707438 14:36013518-36013540 GCTGCCCTTCCTAACAGTGGAGG + Intergenic
1117546211 14:56796605-56796627 GCAGTCCTTACAACCAAGGGAGG - Intergenic
1117875638 14:60248636-60248658 GCTGCCCTTCGAACCCATGGTGG - Intronic
1121032511 14:90671156-90671178 GCTGAACTTTAAACAAATGGTGG + Intronic
1124120223 15:26882718-26882740 GCTGACTTTCCAATCAAAGCAGG - Intronic
1125641154 15:41231489-41231511 GCTGGCCTCACAACCAAGGGCGG + Intronic
1127672359 15:61207439-61207461 GCTGAGCTTCTAGCTAATGGAGG - Intronic
1129073295 15:72970245-72970267 GCTGATCTTACAACCACTGATGG + Intergenic
1133617746 16:7494330-7494352 TCTGGCCTTCCTACCATTGGCGG + Intronic
1135300007 16:21318360-21318382 GCTGAACTTCCAAACACTGGGGG + Intergenic
1137481594 16:48856380-48856402 TCTGACTTTCCAACCAAATGAGG + Intergenic
1138733252 16:59219993-59220015 GCTGAGCTTCCAACCAAGTAAGG + Intergenic
1139951390 16:70673361-70673383 GCTGACCTTCCAACCAATGGTGG + Intronic
1140195243 16:72849656-72849678 GCTGGCCTCCTAACCAATGGCGG + Intronic
1140947265 16:79780762-79780784 CCTTACCTGCAAACCAATGGGGG + Intergenic
1154423086 18:14251715-14251737 TCTGACCTCCCCACCCATGGTGG - Intergenic
1155860515 18:30891894-30891916 GCTGACTTCACAACCAATGTTGG - Intergenic
1158123102 18:54072024-54072046 GCTGCCCTACCAACCAATGATGG + Intergenic
1159119645 18:64153806-64153828 CCTGACCTACCAACCTAAGGAGG + Intergenic
1159861789 18:73658311-73658333 GCTGACCTGTGAACCAATGATGG + Intergenic
1162489103 19:10981273-10981295 GCTGGGCTTCCCACCTATGGAGG + Intronic
1162731021 19:12719015-12719037 GCTGCCCCTCTCACCAATGGTGG + Exonic
1167972637 19:53197977-53197999 GCTCACCTTCCCACCATGGGAGG - Intergenic
930847006 2:55917234-55917256 GCTGACCTTCCAACCCAGGAAGG - Intronic
931367019 2:61627870-61627892 GCTGAACTTCCTGCCAGTGGAGG - Intergenic
932607850 2:73176446-73176468 GCTGTCCTTCCGACCTCTGGGGG - Intergenic
942798589 2:179850286-179850308 GCTGAGCTTCCACTCAATGCAGG + Intronic
947151708 2:227122757-227122779 TCTGACCTTCTACCCAATGTGGG - Intronic
947870708 2:233436327-233436349 GGTTTCCTTCCAACCACTGGTGG - Exonic
1180732316 22:17991299-17991321 GCAGTCATTCCCACCAATGGTGG + Intronic
1181517005 22:23420301-23420323 GCAGTCATTCCCACCAATGGTGG + Intergenic
975490006 4:74977473-74977495 GCTGAACCTACAACTAATGGGGG + Intronic
983934548 4:173492256-173492278 TCTGACTTTCAAACCAAAGGAGG - Intergenic
984908893 4:184653404-184653426 ACTGATCTTTCAACCAAAGGGGG - Intronic
985869215 5:2540689-2540711 GTTGACCTTCCTAGCAATGCTGG + Intergenic
988482784 5:31643460-31643482 GATGCCCTTCCAAACCATGGAGG - Intronic
988819680 5:34869186-34869208 ACTGACATTCCAACGAATGTGGG - Intronic
994156506 5:96509463-96509485 TCTGACCTTTCAACCAAAGGGGG + Intergenic
998555825 5:143122775-143122797 TCTGACCTTCCAATAAATGAGGG - Intronic
1002085154 5:176770136-176770158 GCTGCCCCTCCAGCCAATGCCGG + Intergenic
1018695856 6:166390915-166390937 CCTGCTCTTCCTACCAATGGTGG - Intergenic
1025215643 7:57053771-57053793 GTTGACCTTCAAACCATAGGTGG - Intergenic
1025655734 7:63516930-63516952 GTTGACCTTCAAACCATAGGTGG + Intergenic
1027420776 7:78015707-78015729 GGTCACCTTCCAAGCAGTGGAGG - Intergenic
1031341625 7:120609807-120609829 GCTGAGCTTTCAACCAAGTGTGG + Intronic
1035099157 7:156382322-156382344 CCTGAGCTCCCAGCCAATGGGGG + Intergenic
1036520645 8:9488591-9488613 TCTGACCTTCAAAGCAATGCAGG - Intergenic
1037636717 8:20706670-20706692 GCTCATCTTCCAGGCAATGGGGG - Intergenic
1038195728 8:25365641-25365663 TCTGACCCTCCCACCAATTGTGG + Intronic
1039613470 8:38937086-38937108 GCTGCCCCTCCAGCCAAGGGTGG - Intronic
1041207537 8:55513442-55513464 GCTGCCCTTCCCACAAATAGGGG + Intronic
1042141426 8:65682872-65682894 GCTGATCTTGAAACCAATGACGG - Intronic
1042170819 8:65989373-65989395 GCAGACCTTCCAACTACTGTAGG - Intergenic
1046210067 8:111060393-111060415 GCTGACCTTCTCACAAATGCTGG + Intergenic
1055282537 9:74691035-74691057 TCTGCACTTCCAAACAATGGAGG - Exonic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1057247568 9:93469859-93469881 GCTAACCTTCCAACAAAATGTGG + Intronic
1059371425 9:113842688-113842710 GCTTTCCTTCCAGCCCATGGTGG - Intergenic
1060978612 9:127779676-127779698 GCCAACCTGCCAACCAGTGGGGG + Intergenic
1190567147 X:51742744-51742766 GCTGGCCTGCCATTCAATGGTGG - Intergenic
1193145335 X:78070088-78070110 TCCAACCTTCCAACCAATAGAGG + Intronic
1193390144 X:80916408-80916430 GCTGACATTACAGCCAATGGGGG + Intergenic
1193892716 X:87070350-87070372 TCTGAAATTCCAATCAATGGAGG + Intergenic