ID: 1139954298

View in Genome Browser
Species Human (GRCh38)
Location 16:70685943-70685965
Sequence CCGGGGTCGCGGGCCTCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139954281_1139954298 21 Left 1139954281 16:70685899-70685921 CCTCCCGCCTCCAGGCTGCGCTC 0: 1
1: 0
2: 1
3: 44
4: 401
Right 1139954298 16:70685943-70685965 CCGGGGTCGCGGGCCTCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 119
1139954282_1139954298 18 Left 1139954282 16:70685902-70685924 CCCGCCTCCAGGCTGCGCTCAGC 0: 1
1: 0
2: 3
3: 50
4: 409
Right 1139954298 16:70685943-70685965 CCGGGGTCGCGGGCCTCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 119
1139954291_1139954298 -7 Left 1139954291 16:70685927-70685949 CCGGCCGCGCCGCGCTCCGGGGT 0: 1
1: 0
2: 0
3: 12
4: 203
Right 1139954298 16:70685943-70685965 CCGGGGTCGCGGGCCTCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 119
1139954283_1139954298 17 Left 1139954283 16:70685903-70685925 CCGCCTCCAGGCTGCGCTCAGCG 0: 1
1: 0
2: 2
3: 19
4: 289
Right 1139954298 16:70685943-70685965 CCGGGGTCGCGGGCCTCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 119
1139954287_1139954298 11 Left 1139954287 16:70685909-70685931 CCAGGCTGCGCTCAGCGGCCGGC 0: 1
1: 0
2: 3
3: 19
4: 237
Right 1139954298 16:70685943-70685965 CCGGGGTCGCGGGCCTCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 119
1139954285_1139954298 14 Left 1139954285 16:70685906-70685928 CCTCCAGGCTGCGCTCAGCGGCC 0: 1
1: 0
2: 1
3: 18
4: 264
Right 1139954298 16:70685943-70685965 CCGGGGTCGCGGGCCTCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 119
1139954280_1139954298 26 Left 1139954280 16:70685894-70685916 CCGGGCCTCCCGCCTCCAGGCTG 0: 1
1: 0
2: 7
3: 85
4: 670
Right 1139954298 16:70685943-70685965 CCGGGGTCGCGGGCCTCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139954298 Original CRISPR CCGGGGTCGCGGGCCTCCGG CGG Exonic