ID: 1139954677

View in Genome Browser
Species Human (GRCh38)
Location 16:70687362-70687384
Sequence AACCCGATCTCCAGGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139954673_1139954677 -6 Left 1139954673 16:70687345-70687367 CCTTGGGGCCATCATGAAACCCG 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1139954677 16:70687362-70687384 AACCCGATCTCCAGGACAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 103
1139954667_1139954677 13 Left 1139954667 16:70687326-70687348 CCCTGGGGCAGCCAGTACTCCTT 0: 1
1: 0
2: 1
3: 17
4: 171
Right 1139954677 16:70687362-70687384 AACCCGATCTCCAGGACAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 103
1139954672_1139954677 2 Left 1139954672 16:70687337-70687359 CCAGTACTCCTTGGGGCCATCAT 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1139954677 16:70687362-70687384 AACCCGATCTCCAGGACAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 103
1139954668_1139954677 12 Left 1139954668 16:70687327-70687349 CCTGGGGCAGCCAGTACTCCTTG 0: 1
1: 0
2: 0
3: 21
4: 206
Right 1139954677 16:70687362-70687384 AACCCGATCTCCAGGACAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 103
1139954666_1139954677 18 Left 1139954666 16:70687321-70687343 CCAGGCCCTGGGGCAGCCAGTAC 0: 1
1: 0
2: 2
3: 33
4: 356
Right 1139954677 16:70687362-70687384 AACCCGATCTCCAGGACAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139954677 Original CRISPR AACCCGATCTCCAGGACAGA GGG Intergenic
903065336 1:20696514-20696536 GACCCCATCCCCAGGGCAGAAGG + Intronic
905803590 1:40861210-40861232 GACCCGATCCCGAGGAGAGAGGG + Exonic
908997077 1:70168120-70168142 AACCCTATCTCCCAGCCAGAGGG + Intronic
915747055 1:158170096-158170118 AACAAGATTTCCAGCACAGATGG - Intergenic
916961089 1:169890899-169890921 CACTCTATCTCCAGAACAGAGGG - Intronic
917254839 1:173103463-173103485 TACCCTATCACAAGGACAGAGGG + Intergenic
918342263 1:183577700-183577722 AATCATATCTGCAGGACAGAGGG + Exonic
922580069 1:226690485-226690507 AACACACTCTCCAGGACAGGAGG + Intronic
922747256 1:228051270-228051292 GACCCGATGTCAAGGACAGCTGG + Intronic
1064810614 10:19193670-19193692 AACCTGCTCTCCAGGATATAAGG - Intronic
1067546851 10:47198074-47198096 AACCCAAGGTCCAGCACAGAGGG + Intergenic
1071263266 10:83940376-83940398 ATCCAGATCTCTAGGTCAGAGGG - Intergenic
1076034414 10:127187028-127187050 AACCCCATCTCCTGTCCAGAAGG + Intronic
1076502532 10:130948597-130948619 AACCCAATCTGCATGGCAGAGGG + Intergenic
1079333676 11:19553179-19553201 AGCCCCATCTCCAGCCCAGATGG + Intronic
1085291068 11:75399807-75399829 AACGCCTTCTCCGGGACAGAAGG - Intronic
1088635456 11:111815957-111815979 AACCCAACATACAGGACAGAAGG + Intronic
1094361755 12:29638537-29638559 AGCCTTATCACCAGGACAGAGGG - Intronic
1097178241 12:57156023-57156045 GAGGGGATCTCCAGGACAGAGGG + Intronic
1102760745 12:115382635-115382657 AACCCCATCCTCAGGACACAGGG + Intergenic
1102770901 12:115474942-115474964 AACATGATCTCCAGGACCAAAGG + Intergenic
1105975130 13:25466811-25466833 AGCCCAAGCTCCAGGACAGTAGG - Intronic
1107359091 13:39600864-39600886 GACCTCATCTCCAGGACAGTGGG - Exonic
1107419438 13:40233031-40233053 ACCCCTATCTCCAAGACAGTGGG - Intergenic
1109784566 13:67156685-67156707 TACCTCATCTCAAGGACAGAGGG - Intronic
1112240645 13:97678315-97678337 AACCCTGGCTCCAGGACAAAGGG - Intergenic
1113454686 13:110439812-110439834 AAAAGGATCACCAGGACAGAAGG + Exonic
1121035379 14:90699059-90699081 GAACCTATCGCCAGGACAGAGGG - Intronic
1131371823 15:91888230-91888252 AACCCCATCTCTGAGACAGAGGG - Intronic
1133075515 16:3277611-3277633 AAGCCGATTTCCAGGACAGATGG + Intronic
1134682236 16:16134335-16134357 ATGCCGACCTGCAGGACAGAAGG - Exonic
1139678201 16:68539654-68539676 AACCACATCTCCAGGGGAGATGG - Intronic
1139954677 16:70687362-70687384 AACCCGATCTCCAGGACAGAGGG + Intergenic
1142490576 17:276060-276082 AACCTCGTCTCCAGGACAGTTGG + Intronic
1144428749 17:15171033-15171055 AACCAGACCTCCAGGACTCAAGG - Intergenic
1144874194 17:18388637-18388659 GACCCCAACTCCAGGACACAGGG - Intronic
1145158029 17:20555781-20555803 GACCCCAACTCCAGGACACAGGG + Intergenic
1146987137 17:37230702-37230724 AAGCCTGTCTCTAGGACAGAGGG - Intronic
1148641587 17:49192225-49192247 AACCCCAGCTCCAGGGCAGGAGG - Intergenic
1152400932 17:80065692-80065714 CACCGGATCTCTGGGACAGAGGG + Intronic
1153001968 18:463975-463997 AGCCCGAGCTCCAGGAAGGAAGG + Intronic
1155244983 18:23899296-23899318 AAGCAGATCTCTGGGACAGATGG + Exonic
1158613895 18:58968432-58968454 AACCCAATCTCCAAGCCAAAAGG - Intronic
1164645369 19:29855354-29855376 ATCCCAATCACCTGGACAGAAGG + Intergenic
1165045403 19:33100928-33100950 ATCCCCACCTCCAGGTCAGAGGG + Intronic
926920480 2:17935235-17935257 AATACAATCTCCAGGGCAGAGGG - Intronic
927808448 2:26168806-26168828 CACCCCATCTAGAGGACAGATGG - Intergenic
928770165 2:34696035-34696057 AACCACATCTCCAGCACACAAGG + Intergenic
933773189 2:85756357-85756379 AACCCACTCCCCAGGACAGAAGG + Intronic
938071110 2:128308894-128308916 TTCCCTGTCTCCAGGACAGATGG + Intronic
939857755 2:147381050-147381072 GACCAGATTTCCAGGACAGAGGG + Intergenic
946395254 2:219440933-219440955 ATTCCCATCTCCAGGACACATGG + Intronic
948330226 2:237158734-237158756 AACCAGCTCTCCAGGAAAAATGG - Intergenic
1170368255 20:15620090-15620112 AAGCAGTTCTCCAGGACAGAAGG + Intronic
1172801998 20:37582299-37582321 TACCCCATCTCCAGGCCTGAGGG - Intergenic
1173003621 20:39123319-39123341 AACCAGATCTCCAGGTCATTAGG - Intergenic
1180975510 22:19845718-19845740 AGCCTGCTCTCCAGGACAGCAGG - Intronic
1181609740 22:24004482-24004504 AACTCCATCCCCAGCACAGAGGG - Intergenic
1184953738 22:47865371-47865393 TGCCCCATCTCCAGGAGAGAGGG + Intergenic
952001933 3:28796096-28796118 AATCCATTCTACAGGACAGAGGG - Intergenic
952234726 3:31467117-31467139 AACCAGCTCTCCAGGAGGGAGGG + Intergenic
954736558 3:52712516-52712538 TGCCCTATCTCAAGGACAGAGGG + Intronic
954941796 3:54380021-54380043 AACTCTATCCCAAGGACAGAGGG + Intronic
955032118 3:55231859-55231881 AACCCGGTCCAGAGGACAGAAGG - Intergenic
963417860 3:145021373-145021395 AAGCCAATCACCAGGTCAGAAGG - Intergenic
963500428 3:146119055-146119077 AACCCCACCTCCAGCACTGAGGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
971302693 4:25455073-25455095 AGCCTGCTCTCCAGGAAAGAAGG + Intergenic
974094288 4:57345629-57345651 AATCCTATATCCAAGACAGATGG - Intergenic
977168458 4:93730363-93730385 AATCCCATCTCCAGGTCATATGG + Intronic
979122268 4:116918993-116919015 AACTCTATCACAAGGACAGAAGG - Intergenic
984471284 4:180177743-180177765 AACCCCAACTCCATGAAAGATGG + Intergenic
986153219 5:5146999-5147021 AACCCGATATGCAGGACATGGGG - Intronic
986274531 5:6261934-6261956 AATCAGGTCTCCAGGCCAGACGG - Intergenic
989120869 5:38003252-38003274 ATACTGATCTCAAGGACAGATGG - Intergenic
996147134 5:119990477-119990499 AACCCGAAATCCAGAAGAGAGGG - Intergenic
998906952 5:146915567-146915589 AACAACATCTTCAGGACAGAGGG - Intronic
999932639 5:156450191-156450213 AATCCAATCTCCAGGAAAAATGG - Intronic
1001912906 5:175535721-175535743 AATACTATCTCCAGGAAAGATGG + Intergenic
1002856232 6:1040470-1040492 CACACGAGCACCAGGACAGACGG + Intergenic
1002962246 6:1926215-1926237 TTCCTTATCTCCAGGACAGAGGG - Intronic
1012903966 6:105042463-105042485 AACCAGATTTCCAGGAGAGAAGG - Intronic
1014986988 6:128023438-128023460 AACACCAGCTCCAGGGCAGAAGG - Intronic
1018612120 6:165656502-165656524 AATCCCAGCTCCAGCACAGAGGG + Intronic
1020137241 7:5594160-5594182 CCCCCGAGCTCCAGGACAGCCGG - Intronic
1029355193 7:100046585-100046607 AACAGGATCACCAGGACAGAGGG - Intergenic
1031295615 7:119999210-119999232 AAAACTATCTTCAGGACAGAAGG + Intergenic
1033418483 7:141185245-141185267 TGCCTTATCTCCAGGACAGAGGG + Intronic
1034099686 7:148439928-148439950 ATCCTCAGCTCCAGGACAGATGG - Intergenic
1034349512 7:150407045-150407067 AACCAGATCTCAAGGACAGGGGG - Intronic
1035733752 8:1872840-1872862 CACCCTATCTCCATGACAGCAGG - Intronic
1036549229 8:9802113-9802135 AACAGGATTACCAGGACAGATGG + Intergenic
1039542665 8:38384092-38384114 AATTCTATCTCCAGGAAAGAGGG + Intergenic
1039842236 8:41302513-41302535 AATCCGATCTCAGGGACACAAGG + Intronic
1040565286 8:48560685-48560707 ACAGCAATCTCCAGGACAGATGG - Intergenic
1041586276 8:59523620-59523642 AACTTTATCTCAAGGACAGAGGG - Intergenic
1043626009 8:82259227-82259249 AGCCAGAACTCCAGCACAGATGG + Intergenic
1046507712 8:115157838-115157860 AAACAGATCCCCAGGATAGAGGG + Intergenic
1048860411 8:138720518-138720540 AACACCACCTCTAGGACAGAAGG - Intronic
1049032015 8:140045104-140045126 TACCCCATCTCCAGCAGAGATGG + Intronic
1049058782 8:140259449-140259471 AACCCCAGCTTCAGGACAAAGGG + Intronic
1049243346 8:141549682-141549704 ACCAGGGTCTCCAGGACAGAAGG + Intergenic
1053449108 9:38178742-38178764 AAGCCCATCTCCATTACAGAGGG + Intergenic
1058401958 9:104629937-104629959 AGCCCGATATCCAGGAAGGAGGG - Intergenic
1186796125 X:13048109-13048131 TACCAGGTCTCCAGGACTGAAGG + Intergenic
1189368042 X:40404439-40404461 AATCCTATCTACAGGACAAATGG - Intergenic
1190980987 X:55456528-55456550 GACTCCATCTCCAGGACAGCTGG + Intergenic
1190987710 X:55516652-55516674 GACTCCATCTCCAGGACAGCTGG - Intergenic
1192570568 X:72200780-72200802 ATCCAGAACTCCAGGACAGGAGG + Intronic
1194498969 X:94657079-94657101 AACAAGATCTTCATGACAGAAGG + Intergenic
1199861784 X:151807547-151807569 AACCAGCTCACCAGGACACACGG + Intergenic