ID: 1139955364

View in Genome Browser
Species Human (GRCh38)
Location 16:70690573-70690595
Sequence CCCAGGGCCTTGATGGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139955358_1139955364 1 Left 1139955358 16:70690549-70690571 CCAGGGGGTGGGGGAGCTGAGGT 0: 1
1: 1
2: 7
3: 110
4: 764
Right 1139955364 16:70690573-70690595 CCCAGGGCCTTGATGGCACTTGG 0: 1
1: 0
2: 1
3: 21
4: 211
1139955356_1139955364 8 Left 1139955356 16:70690542-70690564 CCAGAAGCCAGGGGGTGGGGGAG 0: 1
1: 2
2: 11
3: 95
4: 729
Right 1139955364 16:70690573-70690595 CCCAGGGCCTTGATGGCACTTGG 0: 1
1: 0
2: 1
3: 21
4: 211
1139955355_1139955364 9 Left 1139955355 16:70690541-70690563 CCCAGAAGCCAGGGGGTGGGGGA 0: 1
1: 0
2: 7
3: 80
4: 596
Right 1139955364 16:70690573-70690595 CCCAGGGCCTTGATGGCACTTGG 0: 1
1: 0
2: 1
3: 21
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139955364 Original CRISPR CCCAGGGCCTTGATGGCACT TGG Intronic
900702204 1:4055427-4055449 ACCATGGCCTTGATGGCAGGTGG + Intergenic
901002081 1:6153961-6153983 CCCAGGGCCTTCAAGTCACAGGG + Intronic
901087334 1:6619330-6619352 CTCATGGCACTGATGGCACTGGG + Intronic
902337407 1:15761328-15761350 CCCAGGCCATCCATGGCACTCGG - Intronic
903169193 1:21541642-21541664 ACCAAGGGCTTCATGGCACTGGG + Intronic
903276678 1:22226317-22226339 CCCATTTCCTTGATGGCACAAGG - Intergenic
903972708 1:27129488-27129510 CCCTGGGCCTTCCTGGCACCAGG - Intronic
905206225 1:36344222-36344244 CCCAGGGCCCACATGTCACTGGG + Exonic
906113407 1:43339285-43339307 CCCATGGCCTTGATGATACTGGG - Exonic
909032473 1:70558963-70558985 CCCAGTGCTATGATGCCACTTGG - Intergenic
909394533 1:75155038-75155060 GGTAGGGCCTTGATGGCACAAGG - Intronic
911411758 1:97518563-97518585 CCAAAGGCCTTGATGTCTCTTGG - Intronic
915029267 1:152862160-152862182 CCCAGGGCATCCAGGGCACTGGG + Intergenic
916558016 1:165909801-165909823 CCCCTGGCCTTGATGGCACTGGG + Intronic
917640702 1:176980628-176980650 CCAATGGACTTGATGACACTGGG + Intronic
918326650 1:183417409-183417431 CCCAGGGTGGCGATGGCACTCGG - Intronic
920045555 1:203130012-203130034 CCCAGGCACTCGCTGGCACTTGG - Intronic
920571211 1:207019327-207019349 GCCATAGCCTTGATGCCACTGGG - Exonic
921175154 1:212586888-212586910 CCCAGGGCCCTGCAGGGACTTGG - Intronic
1063141033 10:3256792-3256814 CCTGGGGCCTTGGAGGCACTCGG + Intergenic
1067346693 10:45443119-45443141 CCCCGGGCCTTGATGGCCTCGGG - Exonic
1067684659 10:48459149-48459171 CCCAGGCCCTGGATGCCCCTGGG - Intronic
1069818781 10:71214847-71214869 CCCAGGGCTTTGATGGATTTGGG + Intronic
1069842429 10:71348171-71348193 CACAGGGCCTGGCAGGCACTGGG - Intronic
1071274988 10:84045549-84045571 CCCAGGGTGTTTATAGCACTGGG - Intergenic
1071515391 10:86293421-86293443 CCCAAGGCATTGCTGGCGCTAGG - Intronic
1073509558 10:104034699-104034721 CCCAGGGCCTCGAGGGCCCCCGG - Exonic
1076338435 10:129726312-129726334 GCCAGGTCCTTGATGGCACAGGG + Intronic
1077468099 11:2743251-2743273 CACAGGGCCTTGAAGACCCTCGG - Intronic
1078464153 11:11538280-11538302 CCCAGGGCTATGATGGGGCTGGG + Intronic
1080453133 11:32395301-32395323 CTCTGGGCCTTGTGGGCACTAGG - Intronic
1081047867 11:38298108-38298130 CACTGGGCCTTGATAACACTAGG - Intergenic
1083726680 11:64632073-64632095 CCGAGAGGCTTGGTGGCACTGGG + Intronic
1084020255 11:66413127-66413149 CCCAGGCCTCTGTTGGCACTTGG - Intergenic
1084191027 11:67498829-67498851 CCCAGGGCCTGGATGGAGCCGGG - Exonic
1084486162 11:69449560-69449582 CCCAGGGCCCCGGTGACACTTGG - Intergenic
1085152666 11:74264588-74264610 GCCAGGCCGTTGCTGGCACTAGG - Intronic
1085235221 11:75009446-75009468 CCCAGGGCCCTGAAGGCCTTGGG - Exonic
1085235222 11:75009446-75009468 CCCAAGGCCTTCAGGGCCCTGGG + Exonic
1085336180 11:75698234-75698256 TGCAGGGCCTTGAAGGCCCTGGG - Intergenic
1085386771 11:76162173-76162195 CCCAGGGCCTTGCTGTGTCTTGG - Intergenic
1087424880 11:97973005-97973027 CCCAGCACCCTGAAGGCACTGGG + Intergenic
1088997222 11:115011496-115011518 CCCAGGGCTTTAATGGGAGTGGG + Intergenic
1089242821 11:117097404-117097426 CCCAGGTTTATGATGGCACTAGG - Intronic
1090880404 11:130827704-130827726 AGCAGGGGCTTGAGGGCACTGGG - Intergenic
1092501412 12:9051132-9051154 CCCAGGGCTTTTATGGACCTCGG - Intergenic
1095956907 12:47812146-47812168 CCCAGGGCCTTGAAGCCAGCTGG - Intronic
1096242330 12:49966094-49966116 CCCAGGGCTGTGATGGAACCTGG - Intergenic
1096781883 12:53996486-53996508 CCCAGGGACTGGAGGCCACTGGG - Intronic
1097018738 12:56005329-56005351 AACAAGGCCTTGATGGCAGTAGG - Exonic
1097193987 12:57233788-57233810 CCAAGGGCCTGGATGGAGCTCGG + Exonic
1100474511 12:94923153-94923175 CCCAGGGCCTTGCTTTCAATAGG - Intronic
1102270171 12:111527148-111527170 CACTGGGCAATGATGGCACTAGG + Intronic
1102528190 12:113526976-113526998 CCCAGTGAGTTGATGGAACTGGG - Intergenic
1103611713 12:122128084-122128106 CCCAGGGCATGGATGGCGCAGGG - Intronic
1103701250 12:122849806-122849828 CCCAGGTCCTTGAGGACTCTTGG + Intronic
1104047354 12:125172785-125172807 CCCAGGGGCTGGTGGGCACTCGG + Intergenic
1104055468 12:125226897-125226919 CCAAGGGCCTAGAAAGCACTAGG - Intronic
1105633429 13:22194602-22194624 CACATGGCCTTGTTGGCATTTGG + Intergenic
1105638291 13:22237157-22237179 CCCCAGGCCTTGAGGGCACCCGG + Intergenic
1106769564 13:32948766-32948788 CGCAGTTCCTTGATGGCTCTAGG + Intergenic
1110488138 13:76070319-76070341 CCCAGGCCCTTGAGTGCTCTAGG + Intergenic
1115649742 14:35394464-35394486 CCCAGGGCCAGGTTGGCTCTGGG + Intergenic
1121613596 14:95298053-95298075 TCCAGGGCCTTGCCCGCACTGGG + Intronic
1122272804 14:100575885-100575907 TCCAGGGCCTGGGTGGCACCAGG + Intronic
1122502986 14:102213635-102213657 CCCAGGGCCCAGCTGGCACGTGG + Intronic
1122657093 14:103269430-103269452 CCGAGGGCCTGGATGGACCTGGG + Intergenic
1122882507 14:104696457-104696479 CCCTGGGCCTTGCCGGCAGTTGG + Intronic
1124621018 15:31273954-31273976 CCCCTGGCCTGGATGGCCCTGGG - Intergenic
1126324033 15:47455815-47455837 CCCAGGGTCTTGAAGCCACATGG - Intronic
1128558048 15:68645101-68645123 CCGAGGCCCTTCATGGCACAGGG + Intronic
1128877683 15:71215369-71215391 CCCAGGGCCTCGAAGTCACTGGG + Exonic
1129523876 15:76202007-76202029 CCCAGGGGCTGGACTGCACTGGG - Intronic
1130416083 15:83696017-83696039 CCCCTGGCCTGGATGGCACATGG - Intronic
1131562585 15:93457378-93457400 ACCAGGGCCCTAATGACACTGGG + Intergenic
1132725937 16:1338398-1338420 CCCACAGCCTGGATGGCGCTGGG - Intronic
1135208109 16:20499615-20499637 TCCAGGTCCTTGCTGGCCCTGGG - Intergenic
1135210790 16:20524085-20524107 TCCAGGTCCTTGCTGGCCCTGGG + Intergenic
1135965268 16:27030111-27030133 CCCAGGTCCTCAATGGCAGTTGG - Intergenic
1136249814 16:28997068-28997090 CCTTGGGCCTTGATCTCACTTGG - Intergenic
1139955364 16:70690573-70690595 CCCAGGGCCTTGATGGCACTTGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1141993548 16:87623239-87623261 CCCAAGGCCTGGCTGACACTCGG + Intronic
1142372996 16:89693348-89693370 CCCTGTCCCTAGATGGCACTTGG + Intronic
1142420350 16:89966122-89966144 CCCAGGTGCTTGCTGGGACTCGG + Exonic
1143856443 17:9854403-9854425 CCTAGGCCCTTGGTGGCCCTGGG + Intronic
1144815048 17:18028142-18028164 CCCAGGGCCTTGTCGGAATTTGG + Intronic
1145166048 17:20614168-20614190 CCCAGGTGCTTGCTGGGACTCGG + Intergenic
1146626153 17:34437048-34437070 ACCAGGCGCTTGATGGCACTTGG - Intergenic
1147538427 17:41335607-41335629 CCCCTGACCTTGAGGGCACTGGG + Intergenic
1148783102 17:50132540-50132562 AGCAGGGCCTTGGTGGCCCTGGG + Intergenic
1150807209 17:68328931-68328953 CCCAGGGCAGTGATGAGACTAGG + Intronic
1151108628 17:71649105-71649127 CCCAGGAACTGGGTGGCACTGGG + Intergenic
1152123488 17:78432941-78432963 CCCAGGGCCTGGATGTGACATGG - Intronic
1152276744 17:79362479-79362501 CGCTGGGCCTGGATGGCACTAGG + Intronic
1152531834 17:80923373-80923395 CCCCGGGCCCTGGTGGCACCTGG + Intronic
1152583430 17:81178974-81178996 CCCAGGGGCTCGCAGGCACTTGG - Intergenic
1152707049 17:81849589-81849611 CCCAGGGCCTTACAGGCACGTGG - Intronic
1156388986 18:36633062-36633084 CGCAGTGCCCTGCTGGCACTTGG + Intronic
1158456873 18:57615959-57615981 CCCAAGGCTTTGATGACAGTAGG - Exonic
1160783852 19:890871-890893 CCCACTGCCTTGAAGGGACTCGG - Intronic
1160921642 19:1523624-1523646 ACCTGGGGCTTGATGGCCCTGGG - Intergenic
1163555966 19:17993074-17993096 CCCAGGGGCTTGGTGGGGCTGGG + Intronic
1164556490 19:29256690-29256712 CCCAGGGCCAGGAGGGCACTGGG - Intergenic
1168713396 19:58514044-58514066 CCCTGCGCCCTGATGGCGCTGGG - Exonic
926245751 2:11121554-11121576 CCCCCGGCCTTGATTGCTCTCGG + Intergenic
926298140 2:11582949-11582971 CCCAGGGTCTTACTGGCATTTGG + Intronic
927509528 2:23635768-23635790 TCCAGTGACATGATGGCACTTGG - Intronic
928176367 2:29036895-29036917 CCCAGGGCCTCCAAGGCTCTTGG + Intronic
928435065 2:31249551-31249573 CCCAGGGCCATGCTGTCCCTTGG + Intronic
929916633 2:46142184-46142206 CCCAGGGCCATGATGGCTCAGGG - Intronic
932631539 2:73347662-73347684 CCCAGTGTCTTGCTGGAACTTGG - Intergenic
935612703 2:105042320-105042342 CCCAGGTCCTTGCTGGCTGTTGG + Intronic
935707388 2:105868945-105868967 AGAAGGGCCTTGATGGAACTGGG - Intronic
936031294 2:109072832-109072854 CTCAGGGCACTGATGGTACTTGG + Intergenic
936797532 2:116224796-116224818 CCCAGCACCTGGATGGCCCTAGG + Intergenic
938074323 2:128323669-128323691 CCCAGGGCCTTGGTGGGACCCGG + Intergenic
943116564 2:183679200-183679222 GCCAGGGGGCTGATGGCACTAGG - Intergenic
944111149 2:196132190-196132212 CCCAGCACCATGAGGGCACTGGG + Intergenic
947838614 2:233192886-233192908 CCCAGATCCTTGCTGGCATTGGG + Intronic
949026927 2:241770664-241770686 CCCAGGGTCCAGAGGGCACTAGG - Intergenic
1169077195 20:2768459-2768481 CCCAGGGCCTTCCTGGAGCTGGG + Intergenic
1169523972 20:6402858-6402880 CCCAGGGGTTGGATGACACTGGG + Intergenic
1171327239 20:24305421-24305443 CCGAGGGCCTTGATGGGATTGGG - Intergenic
1173166808 20:40691545-40691567 CCCAGGGCCTTAATGGGCCACGG - Intergenic
1173521526 20:43703617-43703639 CGCAGGGCCTTGGTGGGCCTAGG + Intronic
1173872445 20:46350491-46350513 CCCAAGGCCTTGAAGGGGCTGGG - Exonic
1173939187 20:46895143-46895165 CCCAGGGCCAGGAAGGCACAAGG + Intronic
1173946357 20:46953926-46953948 CACAGGGCCTTGTAGGCCCTGGG - Intronic
1174554929 20:51387429-51387451 CCCAGGACCCTGATGGCTCAGGG + Exonic
1174646185 20:52087742-52087764 CCAAGGGCCCTGAGGGCTCTGGG - Intronic
1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG + Intronic
1176085446 20:63293643-63293665 TCCAGGGACTTGGGGGCACTCGG + Intronic
1176252024 20:64129648-64129670 CCCAGGGGCTTGGGGACACTTGG + Intergenic
1179972825 21:44845825-44845847 CCCAGGGCCTGGGTGGCGCCTGG - Intergenic
1180171386 21:46060522-46060544 CCCACAGCCTTGGTGGCCCTGGG + Intergenic
1181737305 22:24892139-24892161 CCCTGGCCCAGGATGGCACTGGG + Intronic
1182273184 22:29168733-29168755 CCCAGGGCCTTGTGGGCAGAGGG - Intergenic
1183538573 22:38417029-38417051 CCCAGGGACTTCCTGGCCCTGGG - Intergenic
1184841495 22:47054948-47054970 CCCAGGGCCATGCTGGACCTGGG - Intronic
1185231830 22:49688070-49688092 CGCTGGGCCTGGATGGCTCTTGG - Intergenic
949408736 3:3741406-3741428 CCCAGGACCTAGCTGGCATTTGG + Intronic
949409205 3:3745512-3745534 CCCAGGGCCATGCTGTCTCTGGG + Intronic
950483492 3:13259182-13259204 CCCAGGGCCTGCATGGCAGAGGG - Intergenic
950580117 3:13856404-13856426 CCCAGGGGCTTCATTCCACTTGG - Intronic
951228464 3:20148398-20148420 CCAAGCGCTTTGATGGCTCTTGG - Exonic
951577461 3:24128321-24128343 CCCAGGGACTTGAAGGCAGAGGG + Intronic
952366081 3:32676039-32676061 GCCAGGGGCTTGATGTCCCTGGG + Intergenic
953136173 3:40183560-40183582 CACAGGGGCTTCATGGCCCTCGG - Intronic
953381367 3:42475032-42475054 CCCAGGGTCTTGATAGCTTTGGG + Intergenic
954280265 3:49572318-49572340 CCTAGGGCCTTGAAGTCAGTGGG + Intronic
954972539 3:54663389-54663411 CCCAGGGCCATGAAGGCATGAGG - Intronic
955024539 3:55154820-55154842 CTCAGGGCATTGAAGCCACTTGG + Intergenic
957864261 3:86001917-86001939 CCCAGGGTCATTATGGGACTTGG + Intronic
958572952 3:95911635-95911657 CCCAGGGCTTTTATGGGCCTTGG + Intergenic
960844475 3:121993662-121993684 CCCAGGGCCTGGAGGGAATTGGG + Exonic
961767740 3:129225146-129225168 CCCAGTGCCCTGCTGGCCCTAGG - Intergenic
964759009 3:160115604-160115626 CCCAGTGCTGTGCTGGCACTAGG + Intergenic
967420080 3:189262863-189262885 CCCAGGGCCTTGCTGGCAGCTGG + Intronic
968762499 4:2449870-2449892 CCCATGGCCTGGAGGACACTGGG + Intronic
972714758 4:41634477-41634499 CCAAGGACCCTGATGGCAGTGGG + Intronic
976139147 4:81972101-81972123 CCCAGGCTCCTGATGGCACTGGG + Intronic
976679923 4:87745517-87745539 CCCAGGGCTTTTATGGGCCTGGG + Intergenic
980063364 4:128155626-128155648 CCCAGGGCCCGGATGGCTCCTGG - Intronic
982207387 4:153006755-153006777 CCCGTGTTCTTGATGGCACTTGG - Intergenic
983602799 4:169549081-169549103 CCCAGGGCCCTGGTGGCATAGGG + Intronic
987065364 5:14284942-14284964 TCCAGGGCCCTGGAGGCACTGGG - Intronic
987101003 5:14591127-14591149 GCCAGGGCTTTGGTGGCACGTGG - Intronic
990103939 5:52232200-52232222 CCCATGGCCTTGAAGTCTCTAGG + Intergenic
991481561 5:67086624-67086646 CCCAGGGATTTGCTGGCTCTTGG - Intronic
998254376 5:140573574-140573596 CCCAGGGCCTATGTGGCACTGGG + Intronic
998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG + Intergenic
1000193740 5:158938283-158938305 GTCAGGGCCTGGAAGGCACTAGG - Intronic
1002303869 5:178272381-178272403 GCCAGGGCCTTGCTGGCAGCAGG + Intronic
1002480766 5:179499330-179499352 CCCAGTGCCTTGAGGCCACAGGG + Intergenic
1002481777 5:179506146-179506168 CCCAGGGCCACGAAGGCATTGGG - Intergenic
1002600300 5:180350572-180350594 CCCAGGGCCTGGAAAACACTGGG + Intronic
1006276285 6:33007634-33007656 CCCAGGGCCTTACTAGGACTGGG + Intronic
1006463899 6:34179509-34179531 CCCAGGGCCCTGAGAGCACAGGG + Intergenic
1006920421 6:37624283-37624305 CCCAGGGCCTGTCTGGCACAGGG - Intergenic
1007821056 6:44561066-44561088 CCCGTGGCCTTGCTGGCCCTGGG - Intergenic
1008492829 6:52103748-52103770 CTTGGGGCTTTGATGGCACTAGG + Intergenic
1012717949 6:102701178-102701200 CCCAGGGCCTGGCTCGCCCTTGG - Intergenic
1013067169 6:106694977-106694999 CCCAGGGCCTTTATGACTCTTGG + Intergenic
1013399007 6:109773029-109773051 CCCATGTCCTTGCTGGCAGTTGG + Intronic
1014013172 6:116500123-116500145 CCCAGTGCCTTGCTGGCAGTTGG - Intronic
1015658467 6:135546612-135546634 CCAAGGTCCTTGATGGAACTGGG - Intergenic
1016466245 6:144328132-144328154 CCCAGGGCCTTGATGGTTCAAGG + Intronic
1017705337 6:157117558-157117580 CCCAGGGCCTGCATGGCCCTCGG + Intronic
1018458335 6:163972597-163972619 CCCAGGGCCTTGTCCGCACGTGG + Intergenic
1018782426 6:167080240-167080262 GCCAGGGCCTTGCTGTCACCTGG + Intergenic
1019756483 7:2774467-2774489 ACAAGGGCCCTGATGGCGCTGGG + Intronic
1020382017 7:7557307-7557329 CCCAGGGCAGTGTTGGCACAAGG - Intergenic
1020493327 7:8816632-8816654 CTCAGGGACTTGACAGCACTTGG - Intergenic
1021918233 7:25456637-25456659 CCCTGGTCCCTGATGTCACTGGG + Intergenic
1022040951 7:26580590-26580612 TCCATGGCCTTGATGACAGTGGG - Intergenic
1022473898 7:30698130-30698152 CACGGGGCCTTCATGGCAATGGG - Intronic
1025043858 7:55673916-55673938 CCTAGGGCCTGGAAGGCAATTGG - Intergenic
1025136786 7:56422442-56422464 CCTAGGGCCTGGAAGGCAATTGG - Intergenic
1029479660 7:100804926-100804948 CCCAGGGCTGTGATGGCAGGAGG + Intronic
1030133550 7:106223659-106223681 CCCAGGTCCTTGCTACCACTAGG + Intergenic
1032737728 7:134708205-134708227 CCTACGCCCTTGAAGGCACTGGG - Intergenic
1034361494 7:150503373-150503395 CACAGGGACTCGATAGCACTGGG + Intergenic
1034471166 7:151255087-151255109 CCCTCGGCCTTGAGGGCACCAGG + Intronic
1037179833 8:15992353-15992375 CTCAGGTCCTTGATGACACATGG + Intergenic
1041632301 8:60101641-60101663 CCCTGGTCCTTGATGACAGTGGG + Intergenic
1048855273 8:138681547-138681569 CTCAGGGCCTAGAGGGCATTAGG - Intronic
1049373179 8:142277356-142277378 CCCTGTGCCCTGAGGGCACTGGG - Intronic
1051749840 9:20329266-20329288 CCCAGTTCCTTGCTGGCAGTTGG - Intergenic
1052874843 9:33550075-33550097 CCTAGGGCCTTGAAGGCTGTTGG + Intronic
1052894166 9:33731759-33731781 CCCAGCTCCCTGATGGCCCTGGG + Intergenic
1053501182 9:38594237-38594259 CCTAGGGCCTTGAAGGCCGTTGG - Intergenic
1055395688 9:75871989-75872011 GCCAAGGCCATGATGTCACTAGG - Intergenic
1056546039 9:87614810-87614832 CCCAGGGCCTGGAAGGGACTTGG - Intronic
1057275609 9:93674624-93674646 GCCAGGGGCTTGCAGGCACTGGG + Intronic
1057680576 9:97178750-97178772 CCTAGGGCCTTGAAGGCCGTTGG - Intergenic
1059803668 9:117775580-117775602 CCCAGGGGCTTGAGGGCAATGGG + Intergenic
1060062375 9:120472417-120472439 CCCAGGGCCTGAGTGTCACTTGG + Intronic
1062095755 9:134702298-134702320 CCCAGAGCCAGGATGGCCCTCGG - Intronic
1062532103 9:137006565-137006587 CCCATGGGCTTGAGGGCACTGGG - Intergenic
1062632002 9:137467257-137467279 CCCAGGTCCTTGCTGGTGCTGGG - Intronic
1186219188 X:7331411-7331433 CCAAGAGCCATGAGGGCACTAGG + Intronic
1188299896 X:28495644-28495666 CACTGGGCCTTGATGTCAGTAGG - Intergenic
1192314163 X:70039109-70039131 CCTAAGGACTTGCTGGCACTGGG - Exonic
1195178537 X:102334147-102334169 CCCAGGGCTTTTATGGGCCTCGG + Intergenic
1195180327 X:102352936-102352958 CCCAGGGCTTTTATGGGCCTCGG - Intergenic
1199548385 X:149032131-149032153 CCCAGGCCCCTGATGCCACGTGG + Intergenic
1200213641 X:154357865-154357887 CCCAGGGCCTGGCCAGCACTAGG + Intronic
1200226204 X:154419294-154419316 TCCAGGGCCTGCATGGCACTTGG - Intronic
1201722013 Y:17109284-17109306 CCCAGGGCCTTTGTCTCACTGGG + Intergenic
1202173366 Y:22074390-22074412 CCAAGGGTCCTGAAGGCACTAGG + Intronic
1202217994 Y:22511984-22512006 CCAAGGGTCCTGAAGGCACTAGG - Intronic
1202325191 Y:23684075-23684097 CCAAGGGTCCTGAAGGCACTAGG + Intergenic
1202545580 Y:25985979-25986001 CCAAGGGTCCTGAAGGCACTAGG - Intergenic