ID: 1139955440

View in Genome Browser
Species Human (GRCh38)
Location 16:70690876-70690898
Sequence TCCAGGGCATTGAAGGCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139955430_1139955440 6 Left 1139955430 16:70690847-70690869 CCTAGGTCGTTGCAAAGTAAGGC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1139955440 16:70690876-70690898 TCCAGGGCATTGAAGGCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 128
1139955427_1139955440 25 Left 1139955427 16:70690828-70690850 CCTATCTATGGTATCTCTTCCTA 0: 1
1: 0
2: 1
3: 21
4: 397
Right 1139955440 16:70690876-70690898 TCCAGGGCATTGAAGGCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 128
1139955425_1139955440 27 Left 1139955425 16:70690826-70690848 CCCCTATCTATGGTATCTCTTCC 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1139955440 16:70690876-70690898 TCCAGGGCATTGAAGGCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 128
1139955426_1139955440 26 Left 1139955426 16:70690827-70690849 CCCTATCTATGGTATCTCTTCCT 0: 1
1: 0
2: 1
3: 37
4: 351
Right 1139955440 16:70690876-70690898 TCCAGGGCATTGAAGGCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139955440 Original CRISPR TCCAGGGCATTGAAGGCTAG GGG Intronic
900013083 1:132694-132716 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
900043149 1:488681-488703 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
900064586 1:723678-723700 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
902556592 1:17250513-17250535 TCCAGGGCATTGGATGAGAGGGG + Intronic
903015368 1:20358154-20358176 CTCAGGTCAGTGAAGGCTAGGGG - Intergenic
905261465 1:36722077-36722099 CACAGGGCATTGAAGGACAGGGG + Intergenic
905261584 1:36722866-36722888 CACAGGGCATTGAAGGACAGGGG + Intergenic
909221984 1:72976409-72976431 TCCAGGACATTGGAAGCAAGCGG + Intergenic
912198035 1:107423125-107423147 TTAAGAGCAATGAAGGCTAGAGG - Intronic
912588679 1:110791431-110791453 TCCAGGGAGTTGAAGTCTGGAGG - Intergenic
921321627 1:213945851-213945873 TCCAGGTTTTTGAAGGGTAGGGG - Intergenic
922099484 1:222469694-222469716 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
922261522 1:223949190-223949212 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
922735556 1:227976554-227976576 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
924342685 1:243051366-243051388 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1063294211 10:4786508-4786530 TCAAGGGCAGTGAAGGCAGGTGG + Intergenic
1069684408 10:70308520-70308542 TCCACGGCCTTGAATGCTGGGGG + Intronic
1074678669 10:115881235-115881257 TCAAAGGCAATGAAAGCTAGTGG - Intronic
1076725774 10:132412361-132412383 TCCAGGGCATTGAAGCCCGGTGG - Intronic
1076798795 10:132811304-132811326 TCCAGGGCAGAGGAGGCTGGGGG - Intronic
1076903353 10:133350585-133350607 ACCTGGGCCTTGAAGGCCAGAGG + Intronic
1076969420 11:124898-124920 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1084455865 11:69267867-69267889 ACCAGGGCATTGGAGGCTCTTGG + Intergenic
1084564790 11:69922575-69922597 TGCCCGGCATTGAAGGCCAGTGG - Intergenic
1085037759 11:73309965-73309987 TCTAGGGCATTGAGGGATGGAGG + Exonic
1089284579 11:117397266-117397288 TCCAGGGCCTTGATGCCTGGTGG - Exonic
1089322149 11:117633705-117633727 TCCTTGGGATTGAAGGGTAGGGG + Intronic
1089729271 11:120510715-120510737 TACAGGCCATTGAAGGTGAGAGG + Intergenic
1092595428 12:9998782-9998804 TCGAGGGCATAGAAGTCAAGGGG - Intronic
1101218428 12:102609356-102609378 GTCAGGGCATTGGGGGCTAGGGG + Intergenic
1103542114 12:121673243-121673265 ACCAGGGCCTTGAAGGCCACTGG - Intergenic
1103573011 12:121857374-121857396 TCCAGGCCCCTGTAGGCTAGAGG + Exonic
1112739029 13:102453411-102453433 TCCAGGTCATTGAATGCTCAAGG + Intergenic
1118901034 14:69986033-69986055 TCCAGGGTATAGATGGATAGGGG - Intronic
1122068469 14:99189873-99189895 ACTAGGGAATTGAAGCCTAGAGG + Intronic
1122408595 14:101514517-101514539 TCCAGGCCATTTCAGGTTAGTGG - Intergenic
1124596974 15:31099306-31099328 TCTAGGTCATGGAAGGCTTGGGG + Intronic
1128638092 15:69315961-69315983 TCCTGGGCAGTGAAGCCTCGGGG + Intronic
1131573441 15:93562565-93562587 TGCAGGGCAGCGAAGGCTGGAGG + Intergenic
1132693129 16:1190552-1190574 TCCAGGGCAGGGAGGGCTGGTGG + Intronic
1133026001 16:2989243-2989265 GCTAGGGCAGTGGAGGCTAGAGG - Intergenic
1133596263 16:7296441-7296463 TCCATGTCATTGAGGGCTAGGGG + Intronic
1136295770 16:29301320-29301342 TCCGGGGCATTGATGGCGGGAGG + Intergenic
1139955440 16:70690876-70690898 TCCAGGGCATTGAAGGCTAGGGG + Intronic
1141273991 16:82568466-82568488 TCCAGGGCAATGAAAGATAATGG - Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142451252 16:90174224-90174246 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1146127192 17:30238703-30238725 TCCTGGGCATGGAAGGCAGGAGG + Intergenic
1147218998 17:38917338-38917360 TCAAGGGCAGTGAAGGTCAGGGG + Intronic
1149278270 17:55070526-55070548 TCAAGGGCATAGAAGGCAATTGG + Intronic
1157604717 18:48918765-48918787 TCCAGGGCATTAATGCCAAGTGG - Intergenic
1159890923 18:73952506-73952528 TCCAGGGGTTTGAAGGCATGAGG - Intergenic
1160646225 19:194824-194846 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1161516260 19:4698239-4698261 TCCAGGGTATTGAGAGATAGGGG + Intronic
925421801 2:3718586-3718608 TCCAGGGCCTTGTGGACTAGGGG + Intronic
928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG + Exonic
932090970 2:68805929-68805951 TCCAGGGTATGGAAGCCTGGTGG + Intronic
932105318 2:68936495-68936517 TCCAGGGCTTTGAGGGTTACAGG - Intergenic
936382817 2:112002364-112002386 TCCATGGCATGGGAGGGTAGGGG + Intronic
937501656 2:122485783-122485805 TCCAGGGAAAAGAAGGCTGGGGG + Intergenic
938163590 2:129007900-129007922 GCCAGGGCATTGAGGGCTGCAGG + Intergenic
945941160 2:215951803-215951825 TCCCGGGGATTGAAAGCTGGAGG - Intronic
946014117 2:216590261-216590283 ACCAGGGCAATGAAGGCATGTGG + Intergenic
947239148 2:227975567-227975589 TCCATGGCACTTAAAGCTAGAGG + Intergenic
1170190327 20:13638903-13638925 TCCGGTGCAGTGAAGGCTCGGGG - Exonic
1171151525 20:22830739-22830761 GCCAGGGGGTTGGAGGCTAGAGG - Intergenic
1171313353 20:24164628-24164650 TCCAGGACACTGAAGGCTTCAGG + Intergenic
1172960954 20:38799236-38799258 CCCCAGGCATTTAAGGCTAGTGG - Intergenic
1173575348 20:44109885-44109907 TCCAGGGCAGTGAAAGGGAGGGG - Intergenic
1176279281 20:64291392-64291414 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1180108088 21:45633107-45633129 CACAGGGCCTTGAAGGCTGGGGG - Intergenic
1183947683 22:41335988-41336010 TCCTGGGAAAGGAAGGCTAGTGG + Intronic
949150229 3:757798-757820 TTCAGGGCTTAGAGGGCTAGAGG + Intergenic
949294975 3:2510926-2510948 TCCAGGGCATTCAAAGCAAAAGG - Intronic
950218181 3:11174714-11174736 TCCAGTGCTTTGAAGGCTGGGGG + Intronic
951631120 3:24721876-24721898 TCCAGATAATGGAAGGCTAGAGG + Intergenic
961530553 3:127537492-127537514 TGCAGGGCATTGAGGGCCAGAGG - Intergenic
962667463 3:137669491-137669513 TCCAGGGGATTGAAGGAGTGTGG - Intergenic
962916186 3:139905979-139906001 TCCAGGACATTGAGGTCCAGTGG - Intergenic
967408003 3:189138705-189138727 TCCAGGGAATTAGAGGCTAAGGG + Intronic
967943760 3:194786302-194786324 TCCAGGGCCTTCAAGGATCGAGG - Intergenic
968371456 3:198224702-198224724 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
971264612 4:25086923-25086945 TACAGGGCAGACAAGGCTAGCGG + Intergenic
974148285 4:57972981-57973003 TCCAAGGCATAGAAGCCCAGAGG + Intergenic
979260142 4:118637175-118637197 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
979328233 4:119403453-119403475 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
983562825 4:169118065-169118087 TCCAGGGCCTTGAAAGTCAGTGG - Intronic
985172655 4:187168562-187168584 TCTAGTGCATTAAAGCCTAGGGG + Intergenic
987521385 5:18989015-18989037 TATAAGGCATTGAAGGCTAGTGG + Intergenic
990337876 5:54793003-54793025 TCCAGTGCCTTGAAGAATAGAGG - Intergenic
992126342 5:73646085-73646107 TCCAGGGCAGGGAAGGCAGGAGG - Intronic
992409510 5:76491816-76491838 TGCAGGGCATTTAAGGTGAGGGG - Intronic
998518092 5:142773679-142773701 TCACGGGCTTTGAAGGCTAGAGG + Intronic
1001784097 5:174396827-174396849 ACCAGGGCCTTGAAGGATACAGG + Intergenic
1002730694 5:181330248-181330270 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1002753836 6:143856-143878 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1009490299 6:64282782-64282804 TTCAGAGGATTGAATGCTAGTGG - Intronic
1012397031 6:98810446-98810468 TACAGGGCATTGTAGGCCAGTGG - Intergenic
1014804362 6:125812624-125812646 AGAAGGGCAGTGAAGGCTAGAGG - Intronic
1015469138 6:133583588-133583610 TCCAGGGCATGGGAGGAGAGGGG + Intergenic
1018568952 6:165186685-165186707 CCCAGGGCACTGGAGGCCAGTGG - Intergenic
1018799341 6:167210345-167210367 ACCAGGGCCTGGAAGGCTAGGGG + Intergenic
1020034670 7:4957848-4957870 TCCAGGGTAGGGAAGGCTGGCGG - Intronic
1020596997 7:10219443-10219465 TCCATGGCACTGAAGCCTGGAGG - Intergenic
1020792786 7:12646479-12646501 ACCATGCCATTGGAGGCTAGGGG + Intronic
1023401858 7:39796776-39796798 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1024075838 7:45817418-45817440 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1024638548 7:51310556-51310578 TCTTGGGCAGTGAATGCTAGAGG + Intronic
1024647760 7:51383886-51383908 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1025051599 7:55738373-55738395 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1025128562 7:56364040-56364062 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1030335289 7:108318783-108318805 TCCAGGGCTAGGATGGCTAGGGG - Intronic
1031410400 7:121434424-121434446 TCAAGGACATGGAAGGCTTGGGG + Intergenic
1031884825 7:127235222-127235244 TTCAGGCCATTTAAGGCTAGGGG + Intronic
1032052370 7:128657168-128657190 TCCTGGGCATTGAAGGCTCCTGG + Intergenic
1034479235 7:151307230-151307252 TCCAGGGAACTGAAGGGTGGAGG + Intergenic
1035297624 7:157876150-157876172 TCCAGGGCACTGAGGTCTCGTGG - Intronic
1035478405 7:159159983-159160005 GCCTGGGCATTGAAGGCCTGGGG + Intergenic
1038118486 8:24584775-24584797 TCCAGGGCATTCATGGAGAGTGG - Intergenic
1038475505 8:27863701-27863723 TTCAGGGCATTGAATGCGAGAGG - Intergenic
1044313903 8:90727200-90727222 TCCACTGCACTGAAGGGTAGAGG - Intronic
1045649163 8:104326688-104326710 TCCAGGGTATTGAAGGCCCAAGG - Intergenic
1048276272 8:133068310-133068332 TCCTGGGCACTCAAGGGTAGAGG - Intronic
1048655569 8:136531846-136531868 TCCAGTGTATTGAAGGCAATAGG - Intergenic
1056746703 9:89309955-89309977 TCCAGCGCAGTACAGGCTAGTGG - Intergenic
1060867887 9:127014197-127014219 TTCACACCATTGAAGGCTAGTGG + Intronic
1060904476 9:127292463-127292485 TCCAGTGCTTGGAAAGCTAGCGG + Intronic
1061199809 9:129131289-129131311 TCCAGGGCACAGGAGTCTAGGGG - Intronic
1062314282 9:135958415-135958437 TCCAGGGCAATGGAAGCTAGAGG + Intronic
1062493309 9:136819368-136819390 TCAAAGGCATAGAAGGCTGGGGG + Intronic
1062755103 9:138282758-138282780 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1203579011 Un_KI270745v1:26927-26949 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1187008997 X:15260851-15260873 TCCAGGGCACTGATGGCTTCAGG - Intronic
1189269319 X:39739797-39739819 TCCAAGGCTGTGAAGCCTAGAGG - Intergenic
1191861094 X:65667398-65667420 GCCAGGACGTGGAAGGCTAGGGG + Intronic
1193059642 X:77191628-77191650 TTCAGGGAATGGGAGGCTAGGGG - Intergenic
1195653635 X:107313274-107313296 TCCAGGGTATTACAGGCAAGGGG - Intergenic
1196754672 X:119147713-119147735 TCCACGGCCTAGAAGGCCAGAGG + Intronic
1197711082 X:129668353-129668375 GCCAGGGGATGGAAGGGTAGGGG - Intergenic
1202381631 Y:24279545-24279567 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1202489154 Y:25390581-25390603 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic