ID: 1139955639

View in Genome Browser
Species Human (GRCh38)
Location 16:70691765-70691787
Sequence CCCTCGGATGGCTGAGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 141}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139955639_1139955656 23 Left 1139955639 16:70691765-70691787 CCCCACACTCAGCCATCCGAGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1139955656 16:70691811-70691833 GGGAGCCGATGCCAGCGGTGTGG 0: 1
1: 0
2: 1
3: 11
4: 153
1139955639_1139955647 -9 Left 1139955639 16:70691765-70691787 CCCCACACTCAGCCATCCGAGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1139955647 16:70691779-70691801 ATCCGAGGGCCAGTCTGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 119
1139955639_1139955655 18 Left 1139955639 16:70691765-70691787 CCCCACACTCAGCCATCCGAGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1139955655 16:70691806-70691828 GCAGTGGGAGCCGATGCCAGCGG 0: 1
1: 0
2: 1
3: 14
4: 185
1139955639_1139955653 2 Left 1139955639 16:70691765-70691787 CCCCACACTCAGCCATCCGAGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1139955653 16:70691790-70691812 AGTCTGGGTGGGAGGGGCAGTGG 0: 1
1: 1
2: 3
3: 101
4: 994
1139955639_1139955658 27 Left 1139955639 16:70691765-70691787 CCCCACACTCAGCCATCCGAGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1139955658 16:70691815-70691837 GCCGATGCCAGCGGTGTGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 84
1139955639_1139955649 -6 Left 1139955639 16:70691765-70691787 CCCCACACTCAGCCATCCGAGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1139955649 16:70691782-70691804 CGAGGGCCAGTCTGGGTGGGAGG 0: 1
1: 0
2: 0
3: 40
4: 398
1139955639_1139955657 26 Left 1139955639 16:70691765-70691787 CCCCACACTCAGCCATCCGAGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1139955657 16:70691814-70691836 AGCCGATGCCAGCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 84
1139955639_1139955651 -4 Left 1139955639 16:70691765-70691787 CCCCACACTCAGCCATCCGAGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1139955651 16:70691784-70691806 AGGGCCAGTCTGGGTGGGAGGGG 0: 1
1: 0
2: 3
3: 70
4: 637
1139955639_1139955650 -5 Left 1139955639 16:70691765-70691787 CCCCACACTCAGCCATCCGAGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1139955650 16:70691783-70691805 GAGGGCCAGTCTGGGTGGGAGGG 0: 1
1: 0
2: 2
3: 46
4: 506
1139955639_1139955654 3 Left 1139955639 16:70691765-70691787 CCCCACACTCAGCCATCCGAGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1139955654 16:70691791-70691813 GTCTGGGTGGGAGGGGCAGTGGG 0: 1
1: 0
2: 4
3: 60
4: 696
1139955639_1139955646 -10 Left 1139955639 16:70691765-70691787 CCCCACACTCAGCCATCCGAGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1139955646 16:70691778-70691800 CATCCGAGGGCCAGTCTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139955639 Original CRISPR CCCTCGGATGGCTGAGTGTG GGG (reversed) Intronic
902873954 1:19330074-19330096 TCCTCGGGAGGCTGAGTGGGAGG - Intergenic
903006307 1:20301139-20301161 CCCTGGGATGGCTGGGTGGCAGG + Intronic
907073619 1:51559270-51559292 TTCTGGGCTGGCTGAGTGTGGGG + Intergenic
908769088 1:67580276-67580298 CCCTCTGATGGCTGTGAGGGAGG + Intergenic
912431574 1:109630867-109630889 CCCTGGGATGGCTTGGGGTGGGG + Intronic
912936260 1:114005935-114005957 ACCTGGGATTGCTGAATGTGGGG + Intergenic
916900322 1:169215268-169215290 CCCTCTACTGGCTGAGTCTGGGG + Intronic
918069560 1:181124943-181124965 CTGTCGCATGGCTGACTGTGAGG + Intergenic
920203575 1:204275614-204275636 CCTCCGGCTGGCTGAGTGTCAGG + Intronic
923944298 1:238865146-238865168 CCCTCTGCTGGCTGAGTCTGGGG + Intergenic
1062880584 10:974874-974896 CCCTTGAATGGCAGAGTGGGAGG - Intergenic
1065791252 10:29262837-29262859 CCCTGGGATGGCCAAGTGTTTGG - Intergenic
1068358595 10:55945249-55945271 CTCTCTGCTGGCTGAGTCTGGGG + Intergenic
1069557419 10:69407321-69407343 CCCTCGGAGGGCTGGGGCTGGGG - Intronic
1070855568 10:79605848-79605870 CCCTCGGTTGCTTGAGTGTTTGG + Intergenic
1076437215 10:130454503-130454525 CCCTTGGTTGGCTGAGAGTGGGG + Intergenic
1079408907 11:20168256-20168278 CCCAGGGATGGCTGTTTGTGGGG - Intergenic
1079573675 11:21976502-21976524 CCCTCTGCTGGCTGAGCCTGGGG + Intergenic
1081228258 11:40552321-40552343 CACTCAGTTGGCTGACTGTGTGG - Intronic
1082109353 11:48257116-48257138 CCCACGGATGCCAGAATGTGAGG + Intergenic
1083096230 11:60254302-60254324 CCCAAGTATGGCTGAGTCTGGGG - Intergenic
1083774592 11:64888216-64888238 CCCTGGGAGAGGTGAGTGTGAGG - Intronic
1084702630 11:70797285-70797307 CACTCGGAAGGCTGGGTGGGAGG - Intronic
1084721327 11:70907320-70907342 CCCTCCCATGGCTGAGTGAAGGG + Intronic
1086950994 11:92890256-92890278 TCATGGCATGGCTGAGTGTGAGG + Intronic
1087176865 11:95104336-95104358 TCCTCGGGAGGCTGAGTGGGAGG + Intronic
1088872188 11:113900353-113900375 TCCTTGGAAGGATGAGTGTGGGG - Intergenic
1092114255 12:5987553-5987575 CCCTCGAATGGCTGACAGTCAGG + Intronic
1092738593 12:11607292-11607314 TCCTTGGATGGCTGACTCTGGGG - Intergenic
1093300855 12:17452546-17452568 CTCTCTGCTGGCTGAGTCTGAGG + Intergenic
1096215327 12:49795205-49795227 CTCCTCGATGGCTGAGTGTGGGG + Exonic
1099730043 12:86489115-86489137 TCCTCTGCTGGCTGAGTCTGGGG - Intronic
1106847169 13:33748743-33748765 CTCTCTGCTGGCTGAGTCTGGGG + Intergenic
1106966838 13:35081139-35081161 CCCATGAATTGCTGAGTGTGAGG - Intronic
1108131506 13:47306475-47306497 CCCTCACCTGGCTGTGTGTGTGG + Intergenic
1108440420 13:50447510-50447532 CTCTCTGCTGGCTGAGTCTGGGG + Intronic
1109012554 13:56970254-56970276 TCCTCGGATTTCTGAGGGTGAGG + Intergenic
1112571201 13:100595126-100595148 CCCTAATATGGCTGAGTCTGAGG - Intergenic
1121096630 14:91221994-91222016 CCCCAGGGTGGCTGAGTGTGTGG - Intronic
1121676993 14:95761479-95761501 ACAACGGAAGGCTGAGTGTGGGG + Intergenic
1124989324 15:34655650-34655672 GGCTGGAATGGCTGAGTGTGTGG - Intergenic
1125463834 15:39932085-39932107 CCCTCAGGAGGCTGAGTGGGAGG - Intergenic
1126115048 15:45200593-45200615 CCCTCAGATGGCTGCGAGGGTGG - Intronic
1126333824 15:47564819-47564841 CTCTCTGCTGGCTGAGTCTGGGG - Intronic
1128259638 15:66223911-66223933 CCTTGGGGTGGCTGAGTGTTGGG + Intronic
1128554307 15:68620771-68620793 GCCTCAGCTGGCTGAGTGAGTGG - Intronic
1129207517 15:74045754-74045776 CCTTGGGACGGCTGAGGGTGAGG - Exonic
1132313982 15:100877844-100877866 CACAAGGATGTCTGAGTGTGAGG + Intronic
1132585577 16:704688-704710 CCCTCGGATGCACGGGTGTGGGG + Intronic
1132694821 16:1197263-1197285 CCCAAGGGTGGCTGAGCGTGCGG + Intronic
1136417653 16:30113507-30113529 CCCGCGGACGGCTGAGCGTGTGG - Exonic
1137869380 16:51934685-51934707 CCCTAAGATGCCTGAGAGTGAGG + Intergenic
1138609458 16:58111137-58111159 TCCTCAAATGGCTGAGTGGGTGG - Intergenic
1139955639 16:70691765-70691787 CCCTCGGATGGCTGAGTGTGGGG - Intronic
1141614890 16:85204818-85204840 CCCTTGGCTGGCTGGGTGTGGGG - Intergenic
1142301776 16:89262848-89262870 CTCTCTGCTGGCTGAGTCTGGGG + Intergenic
1146885757 17:36469752-36469774 CTTTCTGATGGCTGAGTCTGGGG + Intergenic
1147443568 17:40461857-40461879 CCCTCCTGTGGCTGTGTGTGAGG + Intergenic
1147599008 17:41734362-41734384 CCCTTGGATGGCCGAGAATGCGG + Exonic
1148189391 17:45668000-45668022 CCCTCAGGTAGCTGAGTGCGTGG + Intergenic
1148473942 17:47914782-47914804 GCCTCAGATGGCTGAGTCTGAGG + Intronic
1151568679 17:74915233-74915255 CCCTTGGCAGCCTGAGTGTGAGG + Intergenic
1152063834 17:78098843-78098865 GCCTCTGATGGCCCAGTGTGGGG - Intronic
1153158774 18:2179495-2179517 CTCTCTGCTGGCTGAGTCTGGGG - Intergenic
1155169938 18:23259902-23259924 CCCACAGATCTCTGAGTGTGGGG - Exonic
1157273564 18:46294598-46294620 CCCTGGGACTGCTGTGTGTGTGG - Intergenic
1158014408 18:52766688-52766710 CCCTCTGCTGGCTGAGTATGGGG + Intronic
1159889460 18:73940279-73940301 CCCTTGGGTGTCTGAGTGTGGGG - Intergenic
1160620848 18:80169536-80169558 CCCTCGGGCGCCAGAGTGTGGGG + Exonic
1160859868 19:1233232-1233254 GGCTGGGAGGGCTGAGTGTGCGG - Intronic
1165733905 19:38163885-38163907 CCTTCTGCTGGCTGCGTGTGGGG + Intronic
1166765509 19:45250673-45250695 CCCTCGGAGGCCTAAGGGTGGGG - Intronic
930871979 2:56180097-56180119 GGCTGGGGTGGCTGAGTGTGTGG + Intergenic
931226374 2:60335394-60335416 TCCTCGTAAGGCTAAGTGTGGGG - Intergenic
931938927 2:67230728-67230750 CTCTCTGCTGGCTGAGTCTGAGG - Intergenic
933129604 2:78655794-78655816 CCCTTGGATGGCTTTTTGTGGGG - Intergenic
934557781 2:95296543-95296565 CCCTCGGATGGGTGAATGGGAGG + Intergenic
934622964 2:95826755-95826777 CCCTTGGCTGGCTGAGGGTGAGG + Intergenic
934810802 2:97275333-97275355 CCCTTGGCTGGCTGAGGGTGAGG - Intergenic
934826890 2:97432606-97432628 CCCTTGGCTGGCTGAGGGTGAGG + Intergenic
937733585 2:125262444-125262466 CCCTGGGAAAGCTGAGGGTGGGG - Intergenic
939968856 2:148638175-148638197 CCCTTGTATGGCTGAGTAAGAGG + Intergenic
946961589 2:224991166-224991188 CCATCAGATGGCTGAGTCTTTGG - Intronic
948375858 2:237519808-237519830 CCCTCTGGGGGCTGAGTGTGGGG + Intronic
948891009 2:240907113-240907135 CCCTCCCATGGCCAAGTGTGGGG + Intergenic
1170109331 20:12787886-12787908 CCCTTAGAGGGCTGAATGTGGGG - Intergenic
1170745251 20:19093190-19093212 CCCTAATATGGCTGAGTCTGTGG + Intergenic
1170757527 20:19217664-19217686 CCTTCTTATGGCTCAGTGTGAGG + Intronic
1182424988 22:30267086-30267108 CCCTAGGAAGGCTGAGGCTGCGG - Intergenic
1183190665 22:36320185-36320207 CCCTCCTATGGTCGAGTGTGGGG - Intronic
1183386351 22:37517801-37517823 CCCACGGTAGGCTGAGGGTGGGG - Intronic
1183478013 22:38046560-38046582 TCCTCTGAGGGCTGAGTGTGTGG + Intergenic
1184932483 22:47691610-47691632 TCCTGGGCTGGCAGAGTGTGTGG + Intergenic
1185014738 22:48336236-48336258 CCCCGGGAGGGCTGATTGTGGGG + Intergenic
1185189528 22:49425634-49425656 CCCTTGGAGGGCTGTGGGTGGGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
961530184 3:127535940-127535962 CCGACTGGTGGCTGAGTGTGGGG - Intergenic
964920570 3:161890953-161890975 CTCTCTGCTGGCTGAGTCTGGGG + Intergenic
965844801 3:172948574-172948596 TACTCGGGTGGCTGAGTGGGAGG - Intronic
967036911 3:185654929-185654951 TCCTCCCATGGATGAGTGTGAGG + Intronic
968755518 4:2413944-2413966 CCCACTGGTGGCTGAGGGTGAGG - Intronic
969700269 4:8764128-8764150 CCCTAGGATGGGTGAGTAGGTGG + Intergenic
972390720 4:38610436-38610458 TACTCGGGGGGCTGAGTGTGGGG + Intergenic
975376591 4:73652952-73652974 CCCTGCCATGGCTGAGAGTGAGG + Intergenic
975947403 4:79724152-79724174 CCCTCTGCTGGCTGAGTCTGTGG + Intergenic
978134299 4:105238284-105238306 TGCTGGGATGGCTGTGTGTGTGG + Intronic
980492956 4:133552969-133552991 CTCTCTGCTGGCTGAGTCTGGGG + Intergenic
980554321 4:134383375-134383397 CTCTCTGATGGCTGAGTCTGGGG - Intergenic
980851575 4:138388806-138388828 CACTCTGATGGCTGAGTTTGAGG + Intergenic
983774095 4:171584511-171584533 GCCTGGGAAGGCTGAGTGTGTGG - Intergenic
984988019 4:185350300-185350322 GCCTCTGATGACAGAGTGTGGGG - Intronic
986988552 5:13525702-13525724 GCCTTGGATGAGTGAGTGTGGGG - Intergenic
990176570 5:53114642-53114664 CTCTCTGCTGGCTGAGTCTGTGG + Intergenic
993098807 5:83511388-83511410 CCTTTGGCTGGCTGAGTGGGAGG + Intronic
995401466 5:111747082-111747104 CACTAGGATGACTGAGTGGGAGG + Intronic
998797159 5:145832804-145832826 TCCTAGGAAGGCTGGGTGTGTGG - Intronic
1001582584 5:172808965-172808987 ACCTCGGGAGGCTGAGTGGGAGG - Intergenic
1001700868 5:173705695-173705717 CCCAGGGCTGGGTGAGTGTGGGG + Intergenic
1009736169 6:67678446-67678468 CCCAAGGATGGGTGAGGGTGAGG - Intergenic
1012541123 6:100363057-100363079 CCCTGGGATGTGTGTGTGTGGGG - Intergenic
1014449031 6:121562272-121562294 ACCTCTGGTGGCTGGGTGTGGGG + Intergenic
1017417090 6:154232708-154232730 GCCTCGGATGTCAGAGTATGTGG - Intronic
1017584830 6:155909230-155909252 CTCTCTGCTGGCTGAGTCTGGGG - Intergenic
1019363669 7:619240-619262 CCCCCTGAGGGCTGTGTGTGGGG - Intronic
1020055802 7:5117001-5117023 CCCTCAGAAGGCTGGGCGTGGGG + Intergenic
1020644272 7:10795326-10795348 CACTCGGAAGGCTGAGGTTGGGG + Intergenic
1022766508 7:33418377-33418399 CCCTTGGGAGACTGAGTGTGTGG + Intronic
1024615560 7:51108765-51108787 CCCAGGGAGGGCTGAGTTTGGGG - Intronic
1025739268 7:64182931-64182953 CCCTCGAAGGGCTGAGTGCCAGG - Intronic
1027375284 7:77542029-77542051 CCCTCTGATGGCTGGGGGTTGGG + Intronic
1032489594 7:132314371-132314393 CCCTCTAAGGGTTGAGTGTGTGG + Intronic
1034432451 7:151047983-151048005 TCCTCAGAGGCCTGAGTGTGGGG + Intergenic
1035774016 8:2173583-2173605 CTCTCGAATGGCTGAATGTCAGG + Intergenic
1035952373 8:4036935-4036957 TCCTAGTATGGGTGAGTGTGGGG + Intronic
1037363397 8:18097431-18097453 CCCTCTGCTGGCTGAGTCTGGGG - Intergenic
1037401463 8:18498861-18498883 GCCGCCGATGGCTGGGTGTGTGG - Intergenic
1038648437 8:29380664-29380686 CCCTCGGATAGCAGATGGTGGGG + Intergenic
1042716001 8:71773211-71773233 CCCTAATATGGCTGAGTCTGGGG + Intergenic
1043337516 8:79194744-79194766 CACTAGGATGGGTGAGAGTGAGG + Intergenic
1044325409 8:90852610-90852632 CTCTCTGCTGGCTGAGTCTGGGG - Intronic
1044838126 8:96315288-96315310 TCCCTGGATGGCTGAGAGTGTGG - Intronic
1047186461 8:122637547-122637569 CCCTTGGGTGGCTGACAGTGTGG - Intergenic
1047356780 8:124129582-124129604 CACCCGGATGGCAGAGTGGGTGG + Intergenic
1048893092 8:138965256-138965278 CCCTCAGATAGGTGTGTGTGTGG - Intergenic
1049311312 8:141935325-141935347 CCCTCAGAGGGCTGGGTGTAGGG - Intergenic
1049737557 8:144217889-144217911 CCCTCGGGTGGCTGCGTTAGAGG + Intronic
1049979409 9:890593-890615 CCATCCACTGGCTGAGTGTGTGG - Intronic
1052976675 9:34416065-34416087 TACTCGGAAGGCTGAGTGGGAGG + Intronic
1057177339 9:93009907-93009929 CCCACGGGTGGGTGAGAGTGGGG + Intronic
1058968124 9:110055780-110055802 CCCTGGGTTGGTTGAGTGTAGGG + Intronic
1060223185 9:121775030-121775052 CCAGCAGATGGCAGAGTGTGTGG - Intronic
1061206508 9:129167038-129167060 CCCTTGGATGGGTGTGTTTGTGG + Intergenic
1062546164 9:137064604-137064626 CCCTCGAAGGGCTGAGTGCCAGG + Exonic
1186458162 X:9727260-9727282 CCCTAATATGGCTGAGTCTGGGG - Intronic
1189005058 X:36986181-36986203 CACTCGGATGGCGGTGTATGCGG + Intergenic
1189922145 X:45912923-45912945 CCATGGGATGCCAGAGTGTGGGG + Intergenic
1191674582 X:63781510-63781532 CCCTCAGATCGCTAAGAGTGGGG - Intronic
1192559117 X:72113850-72113872 CCCCCGTCTGGCTCAGTGTGGGG + Intergenic
1195724740 X:107902934-107902956 CCCTGGGCTGGCTGGGTGGGCGG - Intronic
1201320519 Y:12693637-12693659 CCCTAATATGGCTGAGTCTGAGG + Intergenic
1201637889 Y:16145735-16145757 CTCTCTGATGGCTGGGTCTGGGG - Intergenic