ID: 1139956585

View in Genome Browser
Species Human (GRCh38)
Location 16:70696160-70696182
Sequence CCTGACATGTAACCCAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139956585_1139956591 -8 Left 1139956585 16:70696160-70696182 CCAATCCTGGGTTACATGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1139956591 16:70696175-70696197 ATGTCAGGCACCCATGGATGGGG 0: 1
1: 0
2: 0
3: 6
4: 135
1139956585_1139956595 27 Left 1139956585 16:70696160-70696182 CCAATCCTGGGTTACATGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1139956595 16:70696210-70696232 CTGGTGTTTTAAAAAAAATCTGG 0: 1
1: 0
2: 7
3: 45
4: 527
1139956585_1139956590 -9 Left 1139956585 16:70696160-70696182 CCAATCCTGGGTTACATGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1139956590 16:70696174-70696196 CATGTCAGGCACCCATGGATGGG 0: 1
1: 0
2: 0
3: 13
4: 90
1139956585_1139956594 8 Left 1139956585 16:70696160-70696182 CCAATCCTGGGTTACATGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1139956594 16:70696191-70696213 GATGGGGCTAGTTTGCTTACTGG 0: 1
1: 0
2: 0
3: 8
4: 72
1139956585_1139956589 -10 Left 1139956585 16:70696160-70696182 CCAATCCTGGGTTACATGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1139956589 16:70696173-70696195 ACATGTCAGGCACCCATGGATGG 0: 1
1: 0
2: 0
3: 19
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139956585 Original CRISPR CCTGACATGTAACCCAGGAT TGG (reversed) Intronic
900788302 1:4663512-4663534 GCTGTCATCTACCCCAGGATGGG - Intronic
900853810 1:5164711-5164733 CCTGCCATGTGTCCCAGGGTGGG + Intergenic
901428087 1:9196203-9196225 CCTGACTTGAAACCCAAGGTTGG + Intergenic
901489716 1:9590376-9590398 CCTCTCAGCTAACCCAGGATGGG + Intronic
905196388 1:36281453-36281475 CCTGACATGTAACCCTAACTGGG - Intronic
906108133 1:43306861-43306883 ACTGGCATGAAGCCCAGGATGGG + Exonic
907015026 1:51004383-51004405 CCTGAGATGTCATCCAGGAATGG + Intergenic
907182509 1:52583277-52583299 CCTGGCATCCAACCCAGAATTGG - Intergenic
917794971 1:178526847-178526869 CCTGACCTGTCACCCAAGCTTGG + Intronic
921114417 1:212074482-212074504 ACTGACATGTGACCCAGCCTAGG - Intronic
921329140 1:214018029-214018051 TCAGACATTTAATCCAGGATGGG - Intronic
922894079 1:229087551-229087573 CATGACATGTCTCCCAGGAAGGG - Intergenic
924378339 1:243437440-243437462 ACTGGCATGTCACCCAGGTTTGG + Intronic
1063149881 10:3326737-3326759 CCTGCCATGTAACCCAGCAAGGG - Intergenic
1064071319 10:12230486-12230508 CATGCCATGTACCCCAGGATGGG - Intronic
1065857149 10:29839874-29839896 TCTTACATCTAAACCAGGATGGG + Intergenic
1066143731 10:32534928-32534950 CCTGTCAAGGAACCCAGCATTGG + Intronic
1068026732 10:51655005-51655027 TCTAACAAGTAACCCAAGATGGG - Intronic
1070602055 10:77872902-77872924 CCTGCCCTGAAACCTAGGATGGG + Intronic
1071251402 10:83823347-83823369 CCTGAGCTGTAATCCAGGAAAGG + Intergenic
1075095373 10:119467718-119467740 CCTGACAAGTCCCCCAGGAGAGG - Intergenic
1075406009 10:122196095-122196117 CCTGAGAAGGAACCAAGGATGGG + Intronic
1078101714 11:8334080-8334102 ACTGGCATGTATCCCAGGACAGG + Intergenic
1078659451 11:13275517-13275539 TCTGACATGTAAAGCAAGATAGG - Intergenic
1079441873 11:20523134-20523156 CTTGAAATGTAACCTAGTATGGG + Intergenic
1080076470 11:28156130-28156152 CCTAAAATATACCCCAGGATGGG + Intronic
1081951833 11:47051224-47051246 CCTGACAAGTAAATCAGGAGTGG - Intronic
1084147345 11:67272134-67272156 CCTTCCCTGGAACCCAGGATGGG - Intronic
1085655762 11:78313328-78313350 CTTGACATGTAAAACAGGAGTGG - Intronic
1093255476 12:16861367-16861389 CCTGACATTTTACTCAGGCTAGG + Intergenic
1100059231 12:90552464-90552486 CCTGACACGCAAACCAGGAAAGG - Intergenic
1102580550 12:113883868-113883890 CCTGTAATATAACCCTGGATAGG + Intronic
1102639471 12:114354271-114354293 CATGAAATGAAACCCAGCATAGG - Exonic
1103230289 12:119324595-119324617 CCTCACAAGAATCCCAGGATAGG + Intergenic
1114271120 14:21100904-21100926 CCAGAAAAGGAACCCAGGATGGG + Intronic
1116538714 14:46069462-46069484 GCTGTCATGTAGCCCAGGAATGG + Intergenic
1116739525 14:48736376-48736398 CATGACATCTTACCCAGGGTTGG + Intergenic
1119374086 14:74174807-74174829 CTTGACATGTTGCCCAGGCTAGG - Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122676794 14:103422157-103422179 ACTGAAATGTAACACAGGTTGGG + Intronic
1124485705 15:30113640-30113662 CCTAAAAAGTAAGCCAGGATGGG + Intergenic
1124517869 15:30383627-30383649 CCTAAAAAGTAAGCCAGGATGGG - Intronic
1124540784 15:30582626-30582648 CCTAAAAAGTAAGCCAGGATGGG + Intergenic
1124757872 15:32424956-32424978 CCTAAAAAGTAAGCCAGGATGGG - Intergenic
1126039925 15:44580236-44580258 ACTGGCTTGTAGCCCAGGATCGG + Intronic
1126156209 15:45567868-45567890 CCTATCATGTAACCGAGGTTAGG + Intergenic
1126340646 15:47637349-47637371 CCTGACTTCTAACCCAGAAGGGG - Intronic
1127208887 15:56750317-56750339 CCTGCCATGTGGCCCAGGACTGG - Intronic
1133669060 16:7999836-7999858 CCTGTCATGTGACCAGGGATAGG + Intergenic
1135849814 16:25953137-25953159 CCTGGCTTGTCTCCCAGGATTGG + Intronic
1138170351 16:54843699-54843721 ACTTACATGTGAACCAGGATAGG - Intergenic
1139334708 16:66223615-66223637 CCTGACATGAAACACTGGAGAGG + Intergenic
1139956585 16:70696160-70696182 CCTGACATGTAACCCAGGATTGG - Intronic
1143106073 17:4531181-4531203 CCAGAGATGTAATCCAGGCTAGG + Intronic
1146601387 17:34219919-34219941 GCAAACATGTGACCCAGGATAGG - Intergenic
1147792750 17:43023601-43023623 TCTGACATCTAACCCAGGCAGGG + Intronic
1149231905 17:54544580-54544602 CCTGGGATGAAGCCCAGGATGGG + Intergenic
1149355746 17:55837537-55837559 CAAGACATGTGACCCAGGTTGGG - Intronic
1150695418 17:67400955-67400977 TCTGTCATGTCACCCAGGCTGGG + Intronic
1151886221 17:76924716-76924738 CCTGGCAGGTAACCCAGGCTGGG + Intronic
1153952951 18:10072300-10072322 CCTGACAGGGACCCCAGGCTGGG - Intergenic
1160850044 19:1186451-1186473 CAGGACATGTGACCCAGGCTGGG - Intronic
1162216596 19:9139696-9139718 CCTGACATTTATCACAAGATGGG + Intergenic
1166623148 19:44323040-44323062 CCTGCCAGGAAACCCAAGATGGG + Intergenic
929983815 2:46705962-46705984 CCTGAATTGTGACCCAGGAAGGG + Intronic
937170315 2:119859471-119859493 CTTGAAATGTAATCCTGGATAGG - Intronic
940083150 2:149827794-149827816 CATGTCATGTTACCCAGGATGGG - Intergenic
941845036 2:170123823-170123845 GCGGCCATGTGACCCAGGATTGG + Intergenic
941853248 2:170205460-170205482 CCTGAGATGTGAGCCAGGGTGGG + Intronic
947409030 2:229814427-229814449 TCTAACATGTAACCCACCATAGG + Intronic
947815179 2:233032053-233032075 CCTGACAGCTAACCCAGGCTGGG - Intergenic
948957387 2:241304285-241304307 CTTCACGTGTAACCCAGGCTTGG + Intronic
1170823317 20:19772457-19772479 TCTGACATTAAACCAAGGATGGG + Intergenic
1171059810 20:21945354-21945376 CCTGAGATGTAAACAAGTATCGG - Intergenic
1173129121 20:40371070-40371092 AGTGACATGTGACCCAGGAGCGG + Intergenic
1173692432 20:44973223-44973245 CATTTCATGTAATCCAGGATTGG - Intronic
1174582754 20:51584097-51584119 CCTGCCATGTAACCCAAACTTGG + Intergenic
1177319868 21:19508029-19508051 CCTGACATGCACCCCAAGACAGG - Intergenic
1178618316 21:34153124-34153146 CCTGAGGTGTAACCCGGGAGTGG - Intergenic
1181106550 22:20579167-20579189 CCTGACATGAGACCAAGGACTGG + Intronic
1182749529 22:32630309-32630331 CTTGCCATGTTACCCAGGTTGGG + Intronic
1182850281 22:33468064-33468086 CCTGTCATGTTTCCTAGGATGGG + Intronic
1183932490 22:41243889-41243911 CTTGCCATGTCACCCAGGCTGGG - Intergenic
950240912 3:11369268-11369290 CCTGAGATGCAGCCCAGGAAAGG + Intronic
951219539 3:20054796-20054818 TGAGTCATGTAACCCAGGATTGG + Intronic
953868017 3:46600926-46600948 CCTGCTATGTTGCCCAGGATGGG - Intronic
954802716 3:53196381-53196403 CTTGACCTGTCACCCAGGCTGGG + Intergenic
968630454 4:1648234-1648256 ACTGACAGGTAACCCAGGCTGGG + Intronic
971175576 4:24279383-24279405 CCCTACATGTGACCCAAGATTGG - Intergenic
974118457 4:57609255-57609277 CCTCACAACTTACCCAGGATTGG + Intergenic
982022536 4:151217487-151217509 CCTGAAATGTCACCCAGCACAGG - Intronic
982822513 4:159960224-159960246 CTTGCCATGTCACCCAGGCTGGG + Intergenic
994176705 5:96719182-96719204 CCTGGCAAGTGAGCCAGGATGGG - Intronic
997913801 5:137903363-137903385 CCTGGCCTGTCACCCAGGAGAGG - Intronic
999757509 5:154675868-154675890 CAAGTCATGTAACCCAGGATGGG - Intergenic
1001880903 5:175243332-175243354 CCTGTCATGTTCCCCAGGATTGG + Intergenic
1004529329 6:16439142-16439164 CATAACATGGAACACAGGATGGG - Intronic
1008518097 6:52337121-52337143 GGTGACATGTGACCCAGGTTTGG + Intergenic
1010726001 6:79334131-79334153 CCTGATCTGTAACACAGGTTTGG - Intergenic
1011017146 6:82769328-82769350 TCTGACGTGTAACCCAGGCCTGG + Intergenic
1012809024 6:103934586-103934608 CAGGACATAAAACCCAGGATAGG - Intergenic
1017318434 6:153060005-153060027 CCTGACCTGTAACTCTGTATTGG - Intronic
1020432547 7:8128569-8128591 CCTGTCCTGCCACCCAGGATGGG + Intronic
1026436226 7:70401283-70401305 CCTGAGATGTGTGCCAGGATGGG + Intronic
1038515559 8:28184607-28184629 CCTTACATCTAACACAGGACTGG - Intronic
1042078631 8:65024395-65024417 CCTGACATGAAACTCAAAATAGG - Intergenic
1042222545 8:66487492-66487514 CCTGCTATGTTACCCAGGCTAGG - Intronic
1042658479 8:71127710-71127732 CCTGACATGTAGTCGAGGCTAGG + Intergenic
1048305619 8:133282095-133282117 ACTGGCATGTAACCCTGAATGGG + Intronic
1052694338 9:31856462-31856484 CCTGAAATTGAACCCACGATTGG + Intergenic
1052764140 9:32623312-32623334 CTTGTCCTGTCACCCAGGATGGG + Intergenic
1053062824 9:35044950-35044972 CCAGGCATGGATCCCAGGATGGG - Exonic
1055428388 9:76218758-76218780 CCAAAAATGTAACCCAGGACGGG + Intronic
1058349922 9:104009444-104009466 CTTGTCAGGGAACCCAGGATTGG - Intergenic
1185801671 X:3016877-3016899 CCTCATTTGTAACCCAGGCTGGG - Intronic
1187044271 X:15630669-15630691 CCTGACTTTCAACCCAGCATTGG - Intronic
1199229710 X:145423047-145423069 CTTCACAGGTAACCCAGCATAGG + Intergenic
1199549698 X:149045306-149045328 AATGAAATGTAACCCCGGATGGG - Intergenic
1202337405 Y:23826382-23826404 CCTGACCTGTAAACCAAGAATGG + Intergenic
1202533361 Y:25843689-25843711 CCTGACCTGTAAACCAAGAATGG - Intergenic