ID: 1139956977

View in Genome Browser
Species Human (GRCh38)
Location 16:70697834-70697856
Sequence GCCCCAGATGCCCCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139956974_1139956977 0 Left 1139956974 16:70697811-70697833 CCTGGATCGTGCAGAGCCACTTG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1139956977 16:70697834-70697856 GCCCCAGATGCCCCCAGACATGG 0: 1
1: 0
2: 2
3: 48
4: 253
1139956971_1139956977 25 Left 1139956971 16:70697786-70697808 CCACAGGAGGGAGGCAGGGCTGT 0: 1
1: 1
2: 13
3: 65
4: 527
Right 1139956977 16:70697834-70697856 GCCCCAGATGCCCCCAGACATGG 0: 1
1: 0
2: 2
3: 48
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139956977 Original CRISPR GCCCCAGATGCCCCCAGACA TGG Intronic
900015976 1:150264-150286 GCCTCAGCTGCCCCCATACCTGG + Intergenic
900046239 1:508861-508883 GCCTCAGCTGCCCCCATACCTGG + Intergenic
900068441 1:750573-750595 GCCTCAGCTGCCCCCATACCTGG + Intergenic
900170063 1:1262893-1262915 GCCCCAGGTGCCACCACACAGGG + Intronic
900315791 1:2055755-2055777 GGCCCAGATGCCCCTAGGAAGGG + Intronic
901145169 1:7059997-7060019 GCCACAGCTGCCCCTAGACCAGG + Intronic
902148736 1:14425285-14425307 GTTCCAGATGCCCCCAGCTATGG - Intergenic
902404937 1:16177443-16177465 GCCCCAGATGCCACCACCAAGGG + Intergenic
903773217 1:25777245-25777267 GCCCCAGAGGACCCCAGCCATGG + Intronic
904610736 1:31724990-31725012 GCCCCAGAGGGCCCCAGAGGTGG + Intergenic
904922764 1:34021530-34021552 GGCCCAGAGACCCCCAAACATGG - Intronic
905557521 1:38899251-38899273 GGCCCAGGTACCCCCAGAGAAGG + Intronic
906313018 1:44767300-44767322 GGCCCAGATGCCCCCATACTTGG - Exonic
915021936 1:152787460-152787482 GCCACAGCTGCCCCCAGAGCTGG - Exonic
915023601 1:152805296-152805318 GCCACAGCTGCCCCCAGAGCTGG + Exonic
915315564 1:155026827-155026849 GCATCAGAGGCCCCCAGCCAAGG - Intronic
915538220 1:156550489-156550511 GCCACACATGCCCACACACAGGG - Intronic
916845320 1:168644409-168644431 GCCCCAGATGTCCTCAGCCCAGG - Intergenic
917408960 1:174738064-174738086 GCCCATGATGCCACCAAACATGG - Intronic
921029313 1:211323735-211323757 GCCCCAGACGCCCGAAGACATGG - Intergenic
922103801 1:222495959-222495981 GCCTCAGCTGCCCCCATACCTGG + Intergenic
922264119 1:223968476-223968498 GCCTCAGCTGCCCCCATACCTGG + Intergenic
922718519 1:227888855-227888877 GCCCCAGGTGCCCACAGCCCAGG + Intergenic
922722074 1:227904337-227904359 GCTCCCGCTGCCCCCAGCCAAGG - Intergenic
922887189 1:229029156-229029178 GCCCCAGTTGCCCCGAGTCCTGG - Intergenic
924940416 1:248809583-248809605 GCCCCAGATGGCCCCTCAGATGG + Intergenic
1062991917 10:1827256-1827278 GGCCCTGATGCCTCCACACATGG - Intergenic
1063469128 10:6270477-6270499 GAACCAGATGCCCCAGGACACGG - Intergenic
1066730376 10:38431347-38431369 GCCTCAGCTGCCCCCATACCTGG - Intergenic
1067237324 10:44461869-44461891 GCACCAGGTGGGCCCAGACAGGG + Intergenic
1067296781 10:44979198-44979220 GCCTCAGCTGCCTCCAGACTGGG - Intronic
1067448900 10:46369210-46369232 GCCCCAGATCCCCCCAGCCCAGG - Intronic
1067588473 10:47491555-47491577 GCCCCAGATCCCCCCAGCCCAGG + Intronic
1067635599 10:47999646-47999668 GCCCCAGATCCCCCCAGCCCAGG + Intergenic
1067877924 10:50020749-50020771 GCCCCAGATCCCCCCAGCCCAGG - Intergenic
1067919373 10:50437889-50437911 ACCCCAAATGCCCACTGACAAGG + Intronic
1068939335 10:62665306-62665328 GACCCAGAAGCCACAAGACAAGG + Intronic
1069678992 10:70270406-70270428 CCCACAGATCCCCCCAGTCATGG - Intronic
1069858667 10:71456464-71456486 GCTCCAGATGTGCCCAGACAGGG - Intronic
1070132157 10:73663653-73663675 GCCCCAGATCCCCCCAGCCCAGG + Intronic
1071493626 10:86153148-86153170 GTCCCAGATGCCACCTGACCTGG - Intronic
1071609524 10:87020422-87020444 GCCCCAGATCCCCCCAGCCCAGG - Intronic
1072529614 10:96306670-96306692 GCCCCAGATGCCTGCTGCCAGGG + Intronic
1073497823 10:103910369-103910391 GCCCCTTATAGCCCCAGACACGG - Intronic
1076120858 10:127935514-127935536 GGCCCAGATGCCCTCAGGCTGGG - Intronic
1076849621 10:133086559-133086581 GCCCCAGACGTCCCCAGGCCGGG - Intronic
1076859219 10:133132709-133132731 GCCCACGAAGGCCCCAGACAGGG + Intergenic
1076972567 11:145333-145355 GCCTCAGCTGCCCCCATACCTGG + Intergenic
1077096709 11:802081-802103 GCCCCACATCCTGCCAGACAAGG + Exonic
1077107133 11:847123-847145 GCCAGAGATGCTCCCAGAGAAGG - Intronic
1077190329 11:1253364-1253386 GCCCCAGAAGCCCCTGGGCAGGG - Intronic
1077220598 11:1413790-1413812 GCCACTGATGCCCCCAGAGATGG - Intronic
1080516557 11:33027134-33027156 GTCCCAGATGCCTCCAGGGATGG - Intronic
1081528356 11:43942368-43942390 GCCCGAGCTGCGCCCGGACAGGG - Exonic
1081636678 11:44726748-44726770 GGCCCAGGGACCCCCAGACAAGG + Intronic
1081759706 11:45568654-45568676 GCCTTAGATGCCCCCAGAGGTGG - Intergenic
1081986565 11:47309098-47309120 GCCCCAGATGCCTCCAAGTAAGG - Intronic
1083656530 11:64232423-64232445 ACCCCAGCTGCACCCAGACCGGG + Exonic
1089295388 11:117464271-117464293 GCCCCTGATGCTCCCAGAGAAGG - Intronic
1089403760 11:118180750-118180772 GCCTCAGATGCCCCCAAAATAGG - Intergenic
1089581483 11:119484181-119484203 GCCCCAGCCTCCCCCAGACTAGG - Intergenic
1091001817 11:131916226-131916248 GCCCCAGAAGCCCCAATGCATGG + Intronic
1091583613 12:1803418-1803440 TCCCCAGATGCGCCCACACCAGG + Intronic
1092172873 12:6384391-6384413 GCACCAGAGGCCCCCAGGCCAGG - Exonic
1094173564 12:27520008-27520030 GCTCCAGATTCCCCCAGAACTGG - Intergenic
1095738393 12:45582742-45582764 TACCCAGATGCCTCCAGTCAGGG - Intergenic
1096126130 12:49121123-49121145 GGCCCAGCTGCCTCCAGTCATGG + Intergenic
1096689168 12:53308886-53308908 GCCCCTGATGCTCCCAAACCTGG - Intronic
1097153420 12:56995724-56995746 GACCCAGATGCCTGCACACATGG - Exonic
1097866090 12:64560188-64560210 GTCCCAGATTCCTCCAAACAGGG + Intergenic
1102818086 12:115885178-115885200 GCCCCAGATGCCACCTGGCCTGG + Intergenic
1103265040 12:119622663-119622685 GCCCGAGACCCCCCCAGCCATGG + Intronic
1103733298 12:123042777-123042799 TCTCCAGATGCAGCCAGACAAGG + Intronic
1103939243 12:124492972-124492994 GCCCCTGCTGCCCCCACACAAGG + Intronic
1104709329 12:130974276-130974298 GCTCCAGGTGCCCCCTGAGAAGG - Intronic
1104971894 12:132534537-132534559 GCCCCACATGTGCCCACACAGGG + Intronic
1108593929 13:51934581-51934603 AGCCCAGCTGCACCCAGACAAGG + Exonic
1108663667 13:52608229-52608251 GCCCCTGCAGCTCCCAGACACGG - Intergenic
1113316607 13:109186874-109186896 GCCCAAGATTCCCCTAGAAATGG + Intronic
1113602113 13:111577260-111577282 GCCCGTGATCCCACCAGACAGGG + Intergenic
1113933142 13:113979084-113979106 TCCCCAGATCCCCACAAACAAGG + Exonic
1119259892 14:73231905-73231927 GCCCCAGAGGCCAGCAGTCAAGG - Intergenic
1119732015 14:76957038-76957060 AACACAGATGCCCACAGACAGGG - Intergenic
1121448545 14:93993594-93993616 GCCCCAAATGCCCCTAAACAGGG - Intergenic
1121664134 14:95659030-95659052 CCCACTGATGCCCCCAAACAGGG - Intergenic
1122343985 14:101046673-101046695 GCCCCAGCAGCCCCAAGAAATGG - Intergenic
1122794490 14:104199276-104199298 GTCCCCGATTCTCCCAGACACGG + Intergenic
1122994459 14:105255392-105255414 ACCCCAGATGCCACCTGACACGG + Intronic
1123063862 14:105606487-105606509 GCCCCAAATGCCCACAGCCTGGG - Intergenic
1123069020 14:105632149-105632171 GCCCCAAATGCCCACAGCCTGGG - Intergenic
1123073177 14:105652131-105652153 GCCCCAAATGCCCACAGCCTGGG - Intergenic
1123093100 14:105750901-105750923 GCCCCAAATGCCCACAGCCTGGG - Intergenic
1124635278 15:31361095-31361117 GGCCCACATGCCCCCAGCCTGGG + Intronic
1128352128 15:66898126-66898148 GTCCCTGATATCCCCAGACATGG + Intergenic
1129717682 15:77861669-77861691 ACCCCAGATCCCCAAAGACAAGG + Intergenic
1129720169 15:77873505-77873527 GCCCCAGCTGTCACCAGACAGGG - Intergenic
1130461079 15:84158577-84158599 ACCCCAGATCCCCAAAGACAAGG - Intergenic
1132111461 15:99105077-99105099 GCCCCGGAGGCCCGCAGACTGGG - Exonic
1132632603 16:927062-927084 GGCCCAGAGGCCTCCAGAGATGG + Intronic
1132828262 16:1915615-1915637 CCCCCATTTGCCCCCAGACAGGG + Intronic
1132982392 16:2745180-2745202 GCCCAATCTGCCCCCAGAGAAGG - Intergenic
1133750652 16:8722760-8722782 TCCCCAGATGCGCCCATCCAGGG + Intronic
1133828697 16:9302002-9302024 GTCCCAGATGTCTCCAGAAAGGG - Intergenic
1134677317 16:16099710-16099732 GCCTCAGATTCCCCCAGCCAAGG - Intronic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1136270672 16:29146466-29146488 TCCCCACATCCCCACAGACATGG - Intergenic
1136369250 16:29825713-29825735 GCCCCAGCTGGGCCCAGTCAGGG - Intronic
1136492139 16:30615611-30615633 GCACCAGCTGCCCCCACACAGGG - Intronic
1138179626 16:54932857-54932879 GCCCCAGAAGCCCGAGGACAAGG + Exonic
1138438178 16:57018274-57018296 GGCCTAGATGGCACCAGACAAGG - Intronic
1138487892 16:57358478-57358500 GTCCCAGAGACACCCAGACATGG + Intergenic
1139952252 16:70678140-70678162 GGCCTTGATGCCCCCAGCCAGGG + Intronic
1139956977 16:70697834-70697856 GCCCCAGATGCCCCCAGACATGG + Intronic
1141393580 16:83684943-83684965 GCCCCACACGGCCCCACACAGGG + Intronic
1141515902 16:84544762-84544784 GCCCCTGATGCCCCCGGCCCAGG - Intronic
1141555331 16:84833510-84833532 ACCCCTGATGCTCCCAGGCAGGG - Intronic
1142074251 16:88108247-88108269 TCCCCACATCCCCACAGACATGG - Intronic
1142226655 16:88880909-88880931 GGCCCAGGTGCCCTCGGACAAGG + Intronic
1142428606 16:90013841-90013863 TCCCCAGATGCCCCCTAAAATGG - Intronic
1142447683 16:90152188-90152210 GCCTCAGCTGCCCCCATACCTGG - Intergenic
1142459807 17:83135-83157 GCCTCAGCTGCCCCCATACCTGG + Intergenic
1145796852 17:27660572-27660594 GCCCCACACCCCACCAGACAGGG - Intergenic
1148821203 17:50360675-50360697 GCCCCTGCTCCCCACAGACATGG - Exonic
1148822340 17:50366877-50366899 GTACCTGATGCCCCCACACAGGG + Intergenic
1149615284 17:57992341-57992363 CCCTCAGATGCCCCAGGACAGGG + Intronic
1150209929 17:63436331-63436353 GCCCTAGGTGCCCTCAGAGAAGG - Intronic
1150276083 17:63898767-63898789 GCATCAGATGCCCCCAGAGATGG + Intergenic
1150361026 17:64534279-64534301 GGCCCAGATGCCACCTCACAAGG - Intronic
1151209085 17:72530583-72530605 GCCCCAGATAGCTCCAGCCAGGG - Intergenic
1151338492 17:73455210-73455232 GCCCCAGCTGCCTCCAGACCCGG + Intronic
1151340543 17:73468044-73468066 GCTCCAGGTGCCCCCAGACATGG - Intronic
1151554326 17:74839015-74839037 GCCCCAGATGCCCCCGGTGCAGG + Exonic
1151719442 17:75847059-75847081 GCACCAGCTGCCCCGAGCCATGG - Intronic
1152327866 17:79652002-79652024 GCCCTAGATGCCCCCAGCCCTGG + Intergenic
1152907526 17:82977010-82977032 GCCCCAGGTGGCCCCAGGCAGGG + Intronic
1153472422 18:5461975-5461997 GCACCAGATGCCTCCTGCCAGGG + Intronic
1158281099 18:55828308-55828330 GTCCCAAATGCCCCCAAATATGG + Intergenic
1159420764 18:68216607-68216629 GCCCCACATTCCTCCAAACAGGG + Intergenic
1160414430 18:78698282-78698304 GCCCCAGAAGCCCCACCACAGGG + Intergenic
1160528357 18:79549928-79549950 GCCTCACAGACCCCCAGACAGGG + Intergenic
1160649523 19:215643-215665 GCCTCAGCTGCCCCCATACCTGG + Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1160955004 19:1687063-1687085 GCCCCCGAAGCCCCCAGCCCAGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161085263 19:2332262-2332284 GACCCAGATGCTCCCAGACCAGG + Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1161818326 19:6514256-6514278 GACCCAGACGCCCCCACACAAGG + Intergenic
1162800932 19:13110087-13110109 GCCCCAGATCCCCCAGGGCAAGG + Intronic
1163813476 19:19449107-19449129 CCCCCAGATGACACCAGAGAGGG + Intronic
1165081604 19:33310141-33310163 GGGCCAGGGGCCCCCAGACAAGG - Intergenic
1165490761 19:36121510-36121532 GCCCCCTCTGCCCACAGACACGG + Exonic
1165902056 19:39173669-39173691 GCCCGAGGTGCCCCCAGCCCTGG + Exonic
1165968509 19:39605009-39605031 GCTCCTCATGCCCCCAGGCAGGG - Intronic
1165979400 19:39707008-39707030 GCTCCTCATGCCCCCAGGCAGGG - Intronic
1166586208 19:43951503-43951525 GCCCCAGAAACCCCCAAATAGGG - Intronic
1166855011 19:45779044-45779066 CCCCCAGATCACCCCAGAAACGG + Intronic
1167358414 19:49017580-49017602 GACCCAGATGCCCCCAAGGAGGG + Intergenic
1167363651 19:49043686-49043708 GACCCAGATGCCCCCCAACGAGG - Intergenic
1167366126 19:49055877-49055899 GACCCAGATGCCCCCCAACGAGG + Exonic
1167434424 19:49470895-49470917 ACCCCCGAGGACCCCAGACAGGG + Exonic
1167580182 19:50336791-50336813 GGTCCAGATGTCCCCAGACCTGG - Intronic
1167598707 19:50441083-50441105 GGCCCAGCTCCCCCCAGACCAGG - Intronic
1168686464 19:58352247-58352269 CCCCCAGCAGCCCCCAGAGATGG + Intronic
925090430 2:1150825-1150847 ACCCCAGCTGCCTCCACACAGGG - Intronic
925131315 2:1496051-1496073 GTCACAGATGACCCGAGACAGGG - Exonic
925304882 2:2841004-2841026 TCACCAGATGCCCACAGAGAAGG + Intergenic
927603750 2:24467424-24467446 GCACCAGATGGCCCCAGGCCGGG + Intergenic
928442305 2:31302623-31302645 GCCCGAGGTGCCTCCAGAGATGG - Intergenic
929583607 2:43100526-43100548 GCCCCAGAATCCCCGAGTCAGGG + Intergenic
934777905 2:96950578-96950600 GACCCACCTGTCCCCAGACAGGG + Intronic
935150098 2:100426475-100426497 GCTCCAGTTGCAGCCAGACAGGG + Intergenic
936670743 2:114653308-114653330 GCCCTAGAAGCCTCCAGACCTGG + Intronic
937285090 2:120745619-120745641 GCCCCAGAAGCCACCCCACATGG - Intronic
937956393 2:127423715-127423737 GCCCCAGATACGCTCAGACTGGG - Intronic
938743488 2:134254698-134254720 GCCCTAGAAGCTCCCAGATATGG + Intronic
939969701 2:148645131-148645153 GCCCCAGATGCCCACCGGGATGG + Exonic
941074257 2:160989293-160989315 GCCCCAGCTCTCCCCAGACTTGG + Intergenic
947740330 2:232481917-232481939 GCCCCAGATGTCCCCTGGCCGGG + Intronic
949035333 2:241813549-241813571 GCCCCAAATGCCCCCTCACCCGG + Intronic
1169198083 20:3693937-3693959 TCCCCATTTGCCCCCAGCCAGGG - Intronic
1169308410 20:4514711-4514733 TCCCCAGATTCCCACAGCCAAGG + Intergenic
1172889048 20:38250897-38250919 GCCACAGATCCACCCAAACATGG - Intronic
1173178901 20:40786718-40786740 GCCACAGATGCCCTCAGTCTGGG + Intergenic
1173257804 20:41407287-41407309 GCCTCTGATTCCCACAGACAAGG - Intronic
1174120380 20:48260513-48260535 GCCTCAGATGTCCCCAGCCTGGG + Intergenic
1176365731 21:6031743-6031765 GCCCCCGAGGCACACAGACATGG - Intergenic
1179757785 21:43506802-43506824 GCCCCCGAGGCACACAGACATGG + Intergenic
1180039775 21:45269838-45269860 GCCACAGATGCCGTCAGAAAGGG - Exonic
1180086500 21:45510089-45510111 GCCCCGCATGCCGCCTGACAGGG - Exonic
1180548891 22:16526657-16526679 GTTCCAGATGCCTCCACACAGGG - Intergenic
1180855849 22:19044250-19044272 GCCCCAGAGGCCCCTTGATAGGG + Intronic
1182028685 22:27140142-27140164 GAAGCAAATGCCCCCAGACAGGG + Intergenic
1182052068 22:27320928-27320950 CACTCAGATGCCACCAGACATGG - Intergenic
1183430333 22:37761930-37761952 GCCTCCGAGGCCCCCAGCCAGGG + Intronic
1184645697 22:45893435-45893457 GTCCCAGCTGTCCCCAGCCAGGG - Intergenic
1184901916 22:47451610-47451632 GCACCAGCTGCCCCCTGACCTGG + Intergenic
1185059696 22:48599857-48599879 GCCACAGATGCCTCCAGGCTGGG + Intronic
1185265631 22:49901241-49901263 GCCCCAGCATCCCACAGACATGG - Exonic
951268904 3:20602079-20602101 GCCCCTGTTGCCACCAGGCAGGG - Intergenic
954337509 3:49928411-49928433 GCCCCAGATGCCCCTTCTCAGGG + Intronic
956656764 3:71559838-71559860 CCCCCAGCAGCCCCCAGACAAGG - Intronic
956689746 3:71864657-71864679 GACACAGAGGCTCCCAGACACGG + Intergenic
960355822 3:116652063-116652085 GACAAAGATGCCCCCAGACCTGG - Intronic
961367163 3:126407313-126407335 CCCCCAGATCCCCTCAGACCAGG + Intronic
961521353 3:127469005-127469027 GCCCCCGATGCCCCCAGGCCTGG - Intergenic
961821802 3:129579039-129579061 GCCCCAGATACTCCCAGGAAGGG + Intronic
964728679 3:159842291-159842313 GCCCCTGAAGCCCCCATTCATGG - Intronic
968286706 3:197513166-197513188 GCCCCTGATGCCCCCAGGCTGGG - Intronic
968368324 3:198204488-198204510 GCCTCAGCTGCCCCCATACCTGG - Intergenic
968483666 4:848620-848642 GCCCGAGCTGCCCCCAGAGCAGG + Intergenic
969614187 4:8242699-8242721 GCCCCTGATGGCACCAGCCAGGG - Intergenic
971362577 4:25951397-25951419 CCTCCAGCTGCCTCCAGACATGG - Intergenic
981074408 4:140577132-140577154 CCCCCAGATGCCCACAGCCAGGG - Intergenic
985681657 5:1258942-1258964 GACGCAGATGCCCACAGAGAGGG + Intronic
985865132 5:2508714-2508736 CCCCCTGCTGCCCCCGGACATGG + Intergenic
986442930 5:7797419-7797441 GCCCCAGACGCCTCCACACCTGG + Intronic
989103221 5:37839240-37839262 GCCCCAGATGCGCCTGGACCCGG - Intronic
990304657 5:54482386-54482408 GCCCAAGATGTCACCAGCCAAGG + Intergenic
991618478 5:68520617-68520639 GCACCAGATTCCCCCATCCAGGG - Intergenic
992093719 5:73341118-73341140 GCCCCAGATGCTCTCAGATAGGG - Intergenic
993794538 5:92249875-92249897 GCCCCTGCTGCCCTCAGACTGGG + Intergenic
999313622 5:150569698-150569720 GCCCCAGAAGCTCCCAAACCTGG - Intergenic
1002093346 5:176817372-176817394 GCCCTAGGTGTCCCCAGCCAGGG + Intronic
1002455942 5:179345397-179345419 GCTCCAGCTGCCCCCAGATGTGG - Exonic
1002473037 5:179448661-179448683 GCACCACATCCCCCCAGACGGGG - Intergenic
1002481187 5:179501993-179502015 GCACCACATCCCCCCAGACGGGG + Intergenic
1002727545 5:181309715-181309737 GCCTCAGCTGCCCCCATACCTGG - Intergenic
1003198608 6:3938199-3938221 CCCACTGCTGCCCCCAGACATGG - Intergenic
1003773683 6:9336169-9336191 GCCCCAGATTACCCTTGACAAGG - Intergenic
1005572219 6:27156571-27156593 GCTCCATATGCCCCAAGACGAGG - Intergenic
1006169866 6:32086569-32086591 GGCCCAGATGCCACCTGACCTGG - Intronic
1011444589 6:87424057-87424079 GCCCAAGATGTCACCAGAAATGG - Intronic
1011470293 6:87701681-87701703 GCCTCAGCTGCCCCCGGCCATGG - Exonic
1011618637 6:89221303-89221325 ACCCCAGCTGCTCCCAAACAGGG + Intronic
1014177833 6:118349502-118349524 GCCCCAGATGACCTCAGGGAGGG + Intergenic
1015031561 6:128601869-128601891 CCACCAGCTGGCCCCAGACAGGG + Intergenic
1015434636 6:133172199-133172221 GCCCCAGCTGCACCCAGGGAGGG - Intergenic
1017972602 6:159326474-159326496 GCCCCAGATGGACACAGACTGGG - Intergenic
1018699901 6:166418246-166418268 GTCCCAGTTTCCCCCAGAAAGGG + Exonic
1019261492 7:84372-84394 GACCCAGCGGCCCCCAGACAGGG - Intergenic
1019516592 7:1442851-1442873 GCCCCAGGTGCCTCCAGCCTGGG - Intronic
1023417361 7:39946093-39946115 GCCTCAGAATCCCTCAGACACGG - Intergenic
1023828811 7:44027807-44027829 GTCCCTGAGGCCCCCAGACCTGG - Intergenic
1024064137 7:45718777-45718799 GCTCCTGATGCCCCCACCCAGGG - Exonic
1025613268 7:63096496-63096518 GCCCCAGATGCCCCCTCCCAAGG - Intergenic
1027822137 7:83060413-83060435 GCTGCAGCTGCCACCAGACAAGG + Intronic
1029116307 7:98239258-98239280 GCCTGAGATGCTGCCAGACACGG + Intronic
1029539566 7:101174583-101174605 GCCGTAGATGCCCCCCGAGATGG + Exonic
1029739110 7:102482064-102482086 GTCCCTGAGGCCCCCAGACCTGG - Intergenic
1029757111 7:102581243-102581265 GTCCCTGAGGCCCCCAGACCTGG - Exonic
1029775052 7:102680304-102680326 GTCCCTGAGGCCCCCAGACCTGG - Intergenic
1033453950 7:141485738-141485760 GCCAGTGATGCCACCAGACATGG - Intergenic
1034850340 7:154487500-154487522 GCCCCAGCAGCCCACAGACCAGG + Intronic
1035376597 7:158410867-158410889 TGCCCAGGTGACCCCAGACACGG + Intronic
1035376625 7:158410961-158410983 CACCCAGGTGACCCCAGACATGG + Intronic
1037833143 8:22200939-22200961 GCCCTGGATGCGCCCGGACATGG + Intronic
1038005677 8:23427897-23427919 GGCCCACATGCTCCCAGACGAGG + Intronic
1038460185 8:27709666-27709688 TCCCAAGATGCCCAGAGACATGG + Intergenic
1039060262 8:33566981-33567003 GCCCCACATTCCCCCAGCCCGGG - Exonic
1039489898 8:37939703-37939725 TCCCTAGAAGCCCCCAGAGAAGG + Intronic
1044858061 8:96495220-96495242 GCCCCAGAAGCGCCCCGCCAGGG - Intronic
1049213175 8:141395951-141395973 GCCCCATCTGTCCCCAGCCAGGG - Intronic
1049220005 8:141424841-141424863 GCCCCTGAAGCCCCCAGGGAAGG - Intronic
1049379068 8:142303028-142303050 TCCCCAGATGCCCACACACACGG - Intronic
1049615146 8:143572694-143572716 GCCCCACACACCCCCAGCCATGG + Exonic
1049719919 8:144111054-144111076 GACCCAGGTTCCCCCAGCCAGGG + Intronic
1053055863 9:34992744-34992766 GCCCCAGCTGCCCTCAGCCTGGG + Intronic
1053575716 9:39356285-39356307 GCCCCAGATCACCCCACACAGGG - Intronic
1053840236 9:42184242-42184264 GCCCCAGATCACCCCACACAGGG - Intronic
1054097286 9:60914990-60915012 GCCCCAGATCACCCCACACAGGG - Intergenic
1054118692 9:61190619-61190641 GCCCCAGATCACCCCACACAGGG - Intronic
1054589065 9:66991945-66991967 GCCCCAGATCACCCCACACAGGG + Intergenic
1057293870 9:93824386-93824408 GCCCCTGGTGCCCCCACACCCGG + Intergenic
1057806760 9:98225122-98225144 GCCCCAGAGGGCCGCAGGCAGGG + Intronic
1057975461 9:99601597-99601619 GCCCCTGGTGCAACCAGACAAGG + Intergenic
1058525177 9:105850211-105850233 GCCCCAGATCCCATCAGACTTGG - Intergenic
1058896940 9:109408682-109408704 AACGCAGATGCCCCCAGAGAGGG + Intronic
1060965887 9:127712135-127712157 GCCCCAGGTGGCCCCAGTCCTGG + Intronic
1061393012 9:130328034-130328056 GCCACAGAACCCCCCAGCCAGGG - Intronic
1061878471 9:133556673-133556695 TGCCCAGGTGTCCCCAGACATGG - Intronic
1061980651 9:134101626-134101648 GCCCGGGATGCCCCCACACCGGG - Intergenic
1062218127 9:135400017-135400039 GCCCCAGGTGCCTGCAGACAGGG + Intergenic
1062433558 9:136536215-136536237 CCCCCAGCTGCCTGCAGACAGGG + Intronic
1062490986 9:136804830-136804852 TCCCCACCTGCCCCCAGCCAGGG + Intronic
1062752664 9:138267193-138267215 GCCTCAGCTGCCCCCATACCTGG - Intergenic
1203575182 Un_KI270745v1:1968-1990 GCCTCAGCTGCCCCCATACCTGG - Intergenic
1190382746 X:49855410-49855432 GCCCCAGCTGCCACCTGACTTGG - Intergenic
1192081122 X:68048887-68048909 CCCCAAGCTGTCCCCAGACATGG - Intronic
1192198334 X:69047287-69047309 GCCCCAGATACCCCCACATATGG + Intergenic
1192510476 X:71718039-71718061 GCCCCAGGGGCCCACAGCCACGG - Exonic
1192516221 X:71763514-71763536 GCCCCAGGGGCCCACAGCCACGG + Exonic
1195216772 X:102711618-102711640 GCCACAGTTGCCCCCAGAAGAGG - Intergenic
1196798448 X:119521320-119521342 ACCCTAGATGCCCCCAGAGCAGG - Intergenic
1202378177 Y:24256603-24256625 ACCCCAGATCCCCAAAGACAAGG + Intergenic
1202492605 Y:25413518-25413540 ACCCCAGATCCCCAAAGACAAGG - Intergenic