ID: 1139958676

View in Genome Browser
Species Human (GRCh38)
Location 16:70705412-70705434
Sequence GTGGGCCAACCTGGCGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139958667_1139958676 19 Left 1139958667 16:70705370-70705392 CCTGCAGGGCCCTTGGTGGACGC 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1139958664_1139958676 29 Left 1139958664 16:70705360-70705382 CCAGCACTGGCCTGCAGGGCCCT 0: 1
1: 0
2: 1
3: 56
4: 445
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1139958674_1139958676 -10 Left 1139958674 16:70705399-70705421 CCTCTCTGCGCAGGTGGGCCAAC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1139958669_1139958676 9 Left 1139958669 16:70705380-70705402 CCTTGGTGGACGCAGCCTGCCTC 0: 1
1: 0
2: 0
3: 16
4: 206
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1139958673_1139958676 -6 Left 1139958673 16:70705395-70705417 CCTGCCTCTCTGCGCAGGTGGGC 0: 1
1: 0
2: 1
3: 19
4: 256
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1139958668_1139958676 10 Left 1139958668 16:70705379-70705401 CCCTTGGTGGACGCAGCCTGCCT 0: 1
1: 0
2: 1
3: 29
4: 182
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139958676 Original CRISPR GTGGGCCAACCTGGCGCTCA AGG Intronic
900408238 1:2501755-2501777 GTGGGCCAGGCTGGGGCTCGAGG + Intronic
900520379 1:3102484-3102506 GGGGGCCCACCTGCAGCTCAGGG - Intronic
901063224 1:6483310-6483332 GTGGGGGCACCTGGTGCTCAAGG - Intronic
901478979 1:9511127-9511149 GTTGGCCAACCTGGCCAACATGG + Intergenic
905587907 1:39135972-39135994 GTGTGCCAACCTGGCTTTCCAGG + Intronic
905732118 1:40304483-40304505 GTGGGGCAACCAGGCCCTCAGGG - Exonic
906107727 1:43304873-43304895 GCTGGCCAACCTGCGGCTCACGG + Exonic
911355401 1:96812027-96812049 GAGGGCCAACATGATGCTCAAGG - Intronic
912431061 1:109628723-109628745 GTGGGACAAGCTGGCGCGCTGGG + Exonic
915907118 1:159887082-159887104 GGGGTCCAACCTGGAGTTCATGG - Intronic
918014136 1:180616605-180616627 ATGGGCCAAGCTGGTGGTCATGG + Intergenic
920178908 1:204120561-204120583 CGGGGCCAACCTGGCCCCCATGG + Intronic
923509087 1:234633909-234633931 GTGGCCCACTCTGGAGCTCAAGG + Intergenic
1063256942 10:4338981-4339003 GTGGGCAAACCTTGTACTCATGG + Intergenic
1063486186 10:6423250-6423272 GTCAGCCAGCCTGGTGCTCACGG + Intergenic
1071863579 10:89701422-89701444 GTGGGCCGCCCTGGTGCTGACGG - Intergenic
1074859465 10:117499406-117499428 TTGTGGCAACCTGGGGCTCAGGG + Intergenic
1075101017 10:119506319-119506341 GTGGCCCGTCCTGGCGCTCTGGG - Intronic
1076378390 10:130008319-130008341 GTGAGCAAAACTGGTGCTCATGG - Intergenic
1087381375 11:97408964-97408986 GTGGGCCAGCCTGGTGCTGGGGG - Intergenic
1090270198 11:125380670-125380692 GTGGGACAAACTGAGGCTCAGGG + Intronic
1090343128 11:126043357-126043379 GTGGGCCAAGCAGCGGCTCAAGG - Intronic
1101777281 12:107806304-107806326 CTGGGCCTTCCTGGCCCTCAGGG - Intergenic
1102571481 12:113829609-113829631 GGGGGCCACACTGGGGCTCAGGG + Intronic
1105900056 13:24745979-24746001 GTGGGCCACCCCGGCGCGCAGGG + Intergenic
1116106514 14:40514449-40514471 CTGGACCAACCTGGCACTTAGGG + Intergenic
1124447889 15:29754775-29754797 GAGTGCCAACATGACGCTCAAGG - Intronic
1125555733 15:40583141-40583163 GTGGGCCAAGCAGTGGCTCAAGG - Intergenic
1129607705 15:77032825-77032847 GGGGGCCGCCCTGGGGCTCACGG + Intronic
1131806434 15:96127027-96127049 GAGTGCCAAGCTGGAGCTCAGGG - Intergenic
1133856756 16:9556822-9556844 GTGGACGAACCTGTCACTCAAGG - Intergenic
1134215913 16:12316803-12316825 GTGCAGCAACCTGGAGCTCATGG - Intronic
1134536682 16:15032079-15032101 TTTGGCCAGCGTGGCGCTCAGGG + Intronic
1136026211 16:27470641-27470663 GTGGCCTCACCTGGCGCTCCAGG + Intronic
1139628159 16:68208527-68208549 GTGGGCCCACCTGGCCAACATGG + Intronic
1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG + Intronic
1142168751 16:88608799-88608821 TTGAGCCAACCTTGCGCTCCTGG + Intronic
1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG + Intronic
1144875672 17:18395877-18395899 CTGGGACCACCTGGAGCTCAAGG + Intergenic
1145156554 17:20548544-20548566 CTGGGACCACCTGGAGCTCAAGG - Intergenic
1146283796 17:31560969-31560991 GTGGGCCAACCTGGCCGTGATGG - Intergenic
1147689701 17:42307722-42307744 GTGGGCAAAACGGGCACTCACGG - Exonic
1148794376 17:50190080-50190102 GACGGCCAACCTGGTGCTAAAGG - Exonic
1152343332 17:79737348-79737370 GTGGCCCCACTTGGGGCTCAAGG - Intronic
1155272148 18:24150979-24151001 GTGGGCCATCCTGGCTAACACGG - Intronic
1159009280 18:63042958-63042980 GTGGGCCAACCTGGAGCAGGAGG + Intergenic
1162829371 19:13275016-13275038 GGGGGCCACCCTGGAACTCAGGG + Intronic
1163587689 19:18173028-18173050 GGGGGGCAACCTGGCCTTCAAGG - Intronic
1166090655 19:40506557-40506579 GTGGCCCATCCTGCCACTCAGGG - Intronic
1167666508 19:50825630-50825652 GAGGACAAAGCTGGCGCTCAAGG - Intronic
1168297173 19:55383173-55383195 GGGGACCAACCTGGCCCACATGG + Intronic
932764655 2:74462123-74462145 GTGGGCCTGCCTGGCTCTGATGG + Exonic
933758791 2:85660831-85660853 GTGGGCCAAGCTTGCTCTCAAGG + Intronic
937457917 2:122058891-122058913 GTGGTCCAACCTGTGGCCCATGG + Intergenic
946330913 2:219008954-219008976 GTGGGCCAAGGTGGCCCTCCAGG - Intronic
946632324 2:221683725-221683747 GTGGGCCATCCTAGCCCACAAGG + Intergenic
1175996093 20:62812952-62812974 GTCGGCCACCCTGGCTCCCAGGG - Exonic
1176222200 20:63975052-63975074 GTGGGCCAACCTGGAGGTGCTGG + Exonic
1176411141 21:6450240-6450262 CTGGGCCCACCTGGAGGTCAGGG - Intergenic
1179686634 21:43058562-43058584 CTGGGCCCACCTGGAGGTCAGGG - Intronic
1184388200 22:44188064-44188086 GGGGGCCGAGCTGGGGCTCAGGG + Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
950967570 3:17156571-17156593 CAGGGCAAACCTGGCGCTGATGG + Intergenic
955405476 3:58623071-58623093 ATGGGCCTGCCTGGTGCTCAGGG - Intronic
962809685 3:138949784-138949806 GTGGGTGAACCGGGCGCTCCAGG + Intronic
963900306 3:150727078-150727100 CTGGGCCAACCTGGCCCTACAGG + Intergenic
964359001 3:155874688-155874710 GTGGGCCAACTTGTCACTTAAGG + Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
971063045 4:22994006-22994028 GAGGGCCAATCTGGTGATCAGGG - Intergenic
972428298 4:38955900-38955922 GTGGGCCAACCTGGGTCCCCAGG + Intergenic
980811064 4:137881216-137881238 GTGTGCCAACCTGGCATTCAGGG + Intergenic
985514618 5:335106-335128 GTGTGCCACCCTGGGGCACAAGG - Intronic
985663405 5:1168852-1168874 GTGGGCCGGCCTGGTGGTCAGGG - Intergenic
985996469 5:3599960-3599982 GCGGGCCACCCCGGCGCGCACGG + Exonic
986236824 5:5918524-5918546 GAGAGCCAACCTGGCTTTCAGGG + Intergenic
990952342 5:61310863-61310885 CTGGGCCAACCTGGGGCTAGTGG + Intergenic
991947826 5:71916648-71916670 GTATGCCACCCTGGGGCTCAAGG + Intergenic
992139331 5:73780204-73780226 GTGTGCCAACCTGCAGCTCAGGG + Intronic
994827893 5:104739541-104739563 ATAGGCCAACCTGGCAATCAAGG - Intergenic
1013330381 6:109094819-109094841 GCGGCCCAGCCTGGCGCTCGAGG - Exonic
1017012557 6:150072372-150072394 GTGAGTCACCCTGGCCCTCAAGG - Intergenic
1018677782 6:166237310-166237332 GAGGCCCAACGTGGCTCTCATGG + Intergenic
1019216100 6:170444889-170444911 GTGGGCAAACCTGGCACGGATGG - Intergenic
1019704951 7:2493204-2493226 GTGGGGCAACAGGGAGCTCAAGG - Intergenic
1024596465 7:50941581-50941603 GTGGGCCACCCTGGTGATCTTGG + Intergenic
1029021081 7:97364994-97365016 GTATGCCACCCTGGGGCTCAAGG + Intergenic
1032265792 7:130369024-130369046 CTGGGCCAACCTTTCCCTCAAGG - Intergenic
1034446546 7:151116750-151116772 GTGTGCCACCCTGGCCCTGACGG + Intronic
1034558562 7:151865185-151865207 GAGGGCCAGCCTGAAGCTCAGGG - Intronic
1039460103 8:37736709-37736731 CTGGGCCTAGCTGCCGCTCAGGG + Exonic
1045971230 8:108082290-108082312 GGGCGCCAATCGGGCGCTCAGGG - Intronic
1046587671 8:116167732-116167754 TTGGGCCAACCTGACCCCCAGGG + Intergenic
1049219245 8:141421400-141421422 GTGGACCCACCTGGGGTTCATGG + Exonic
1055767168 9:79675946-79675968 GAGCACCAACCTGACGCTCAAGG - Intronic
1056679474 9:88704671-88704693 GGGGGCCAACCTGGGGCTTCTGG + Intergenic
1058932488 9:109735013-109735035 GTGGGCCAAGCTGTTTCTCAAGG + Intronic
1059284590 9:113161743-113161765 CTGGGCCAGCCTGTCTCTCAGGG - Intronic
1060304141 9:122395094-122395116 GTGGTCCAACCAGGAGCTGATGG + Exonic
1060873908 9:127066193-127066215 CTGGGCCAAGCTGGCTCCCAGGG - Intronic
1060939438 9:127535196-127535218 GTCTGCCACCCTGGCCCTCACGG + Intronic
1187733410 X:22279685-22279707 GTGGGCCAAGTTTGCTCTCATGG - Intergenic
1189202042 X:39204805-39204827 GTGGGCCAAAATGGCACTCCAGG - Intergenic
1193953923 X:87835321-87835343 ATGGTCCAACCTGGTGTTCATGG + Intergenic
1200115762 X:153769079-153769101 GAGGGCCATCCTGGGGCTGAAGG + Intronic