ID: 1139958676

View in Genome Browser
Species Human (GRCh38)
Location 16:70705412-70705434
Sequence GTGGGCCAACCTGGCGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139958674_1139958676 -10 Left 1139958674 16:70705399-70705421 CCTCTCTGCGCAGGTGGGCCAAC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1139958669_1139958676 9 Left 1139958669 16:70705380-70705402 CCTTGGTGGACGCAGCCTGCCTC 0: 1
1: 0
2: 0
3: 16
4: 206
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1139958673_1139958676 -6 Left 1139958673 16:70705395-70705417 CCTGCCTCTCTGCGCAGGTGGGC 0: 1
1: 0
2: 1
3: 19
4: 256
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1139958667_1139958676 19 Left 1139958667 16:70705370-70705392 CCTGCAGGGCCCTTGGTGGACGC 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1139958668_1139958676 10 Left 1139958668 16:70705379-70705401 CCCTTGGTGGACGCAGCCTGCCT 0: 1
1: 0
2: 1
3: 29
4: 182
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1139958664_1139958676 29 Left 1139958664 16:70705360-70705382 CCAGCACTGGCCTGCAGGGCCCT 0: 1
1: 0
2: 1
3: 56
4: 445
Right 1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139958676 Original CRISPR GTGGGCCAACCTGGCGCTCA AGG Intronic