ID: 1139959493

View in Genome Browser
Species Human (GRCh38)
Location 16:70709581-70709603
Sequence CAAGGGTACGAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139959486_1139959493 1 Left 1139959486 16:70709557-70709579 CCTCCTAGGGCAATGGTTTGTCT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 186
1139959487_1139959493 -2 Left 1139959487 16:70709560-70709582 CCTAGGGCAATGGTTTGTCTCCA 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 186
1139959485_1139959493 2 Left 1139959485 16:70709556-70709578 CCCTCCTAGGGCAATGGTTTGTC 0: 1
1: 0
2: 0
3: 9
4: 259
Right 1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 186
1139959481_1139959493 17 Left 1139959481 16:70709541-70709563 CCACACTTAGTTCTACCCTCCTA 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 186
1139959480_1139959493 25 Left 1139959480 16:70709533-70709555 CCTGTGATCCACACTTAGTTCTA 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139959493 Original CRISPR CAAGGGTACGAGAGGGAAGC AGG Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902468263 1:16631111-16631133 TGAGGGTAAGGGAGGGAAGCAGG + Intergenic
905086724 1:35386420-35386442 CAAGAGGAAGAGAGAGAAGCGGG + Intronic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
906237681 1:44221708-44221730 CAAGGGTGGGGGTGGGAAGCAGG + Intronic
906832120 1:49044189-49044211 CAAGAGGAAGAGAGGGAAGTAGG + Intronic
907552767 1:55318423-55318445 CAAGGAGAGGAAAGGGAAGCGGG - Intergenic
909278069 1:73714265-73714287 CAAAGGTGAGAGAGGGAAGAAGG + Intergenic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
910098615 1:83552596-83552618 CAAGGGTGTGAGAGGTGAGCGGG - Intergenic
912383576 1:109260462-109260484 GAAGAGTATGAGAGAGAAGCTGG - Intronic
915281105 1:154822708-154822730 CAAGGGCAGGGGAGGGAGGCAGG + Intronic
917146698 1:171899974-171899996 CAAGGATGCAAGAAGGAAGCTGG + Intronic
918132869 1:181644713-181644735 TAAAGGTATGTGAGGGAAGCAGG + Intronic
923776098 1:236979877-236979899 CAAGGACACCAGAGGAAAGCAGG + Intergenic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
1064695504 10:17961197-17961219 CAAGGCTAAGAGAAGGAAGGAGG + Intronic
1065169106 10:23010180-23010202 GAAGGGAAGGAGAGGGAAGCTGG - Intronic
1066473694 10:35724244-35724266 CAAGGGTACTAGAGGAAAGCAGG + Intergenic
1067794761 10:49312772-49312794 CCATGGTAAGAGATGGAAGCAGG - Intronic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069276221 10:66594350-66594372 TAAGGGTACAAGATGGAAGTAGG - Intronic
1070041085 10:72780683-72780705 GAAGGTTAGGAGAGGGCAGCAGG - Intronic
1073558033 10:104472372-104472394 CAAGGGTAGAAGGGGTAAGCTGG - Intergenic
1074781767 10:116807361-116807383 CAGGGGTAAGAGGGGAAAGCAGG - Intergenic
1077051234 11:568024-568046 CACGGGGACGCGAGGGCAGCTGG - Intergenic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1080249683 11:30219032-30219054 GAAGGGTAGAAAAGGGAAGCTGG - Intergenic
1082281833 11:50278873-50278895 AAAGAGCTCGAGAGGGAAGCAGG + Intergenic
1084670560 11:70604268-70604290 CAAGAGCACGAGAGTGAAGCTGG + Intronic
1084865044 11:72048845-72048867 CAAGGGTTAGAGGGGGAGGCTGG + Intronic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085420485 11:76354142-76354164 CTAAGGTAGAAGAGGGAAGCAGG + Intronic
1086950735 11:92887810-92887832 CCAGGGCAGGGGAGGGAAGCAGG + Intronic
1087343120 11:96934471-96934493 CAAAGGAACTAGATGGAAGCAGG + Intergenic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1088724349 11:112621079-112621101 GAAAGGCACGAAAGGGAAGCTGG + Intergenic
1089116144 11:116096784-116096806 CAAGGGCAGGAAAGGGAAGTCGG + Intergenic
1089689604 11:120179107-120179129 CAAGGGCCAGAGAGGGAAGCTGG + Intronic
1092534894 12:9378662-9378684 CAAGGGCAGGAAGGGGAAGCTGG - Intergenic
1098060144 12:66553333-66553355 CAAGGGAGGGAGAGGGAAGGAGG - Intronic
1101843168 12:108342162-108342184 CAAGGGGAGGAGAGGGGAGAGGG + Intergenic
1103621518 12:122189994-122190016 CAAGGGTAGGACAGGGGTGCAGG + Intronic
1106159142 13:27185025-27185047 CAAGGCTATGTGAGGGAAGAGGG + Intergenic
1108133423 13:47328814-47328836 GAAGGGTCAGAAAGGGAAGCAGG - Intergenic
1108416848 13:50206214-50206236 CCAGGGTAGGGGAGAGAAGCAGG + Intronic
1108576933 13:51798976-51798998 CAAGCTTAGGGGAGGGAAGCGGG + Intronic
1109305059 13:60629434-60629456 CTAGGGTACTAGAAGGAAGATGG - Intergenic
1109491189 13:63101659-63101681 CAAGGGTAAGAGAGAGAAGCGGG - Intergenic
1110713038 13:78670962-78670984 AAAGGGTAGGAGAGGGAAGTAGG - Intergenic
1110841228 13:80145844-80145866 CTAGGGTAGAAGAGAGAAGCAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112632914 13:101181319-101181341 CACGGATAAGAGAGGGAGGCTGG + Intronic
1113251544 13:108458540-108458562 GAAGGGGGAGAGAGGGAAGCGGG - Intergenic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1120371954 14:83646894-83646916 CAAGGGTAGAGGAGGGAACCTGG + Intergenic
1122069430 14:99196072-99196094 CGAGGCTTCGAGAGGGCAGCTGG + Intronic
1128582486 15:68819260-68819282 CAAGGGGCCAAGAGGGGAGCTGG + Intronic
1128702575 15:69814940-69814962 CAAGGGACCAAGAGGGATGCAGG + Intergenic
1131850750 15:96541034-96541056 GAAGGGTCCGGGAGGGAAGAAGG + Intergenic
1132186423 15:99805888-99805910 CAAGGGGAGGAGGGGGCAGCCGG + Intergenic
1132429255 15:101746822-101746844 CAAGGGGAGGAGGGGGCAGCCGG - Intergenic
1132640892 16:977786-977808 CCAGGGCACGAGGAGGAAGCAGG - Intronic
1133036064 16:3035108-3035130 CAAGGGAAGGAGAGAGGAGCTGG - Intronic
1133225268 16:4337819-4337841 CCAGGGTGGGAGAGGGAAACGGG - Exonic
1135138885 16:19905044-19905066 CAAGAGTACAAGAGGGAGGAAGG + Intergenic
1135936648 16:26786046-26786068 CAAGGGCACCACAGGGAACCAGG + Intergenic
1137798634 16:51242625-51242647 AAAGGGAAAGGGAGGGAAGCAGG - Intergenic
1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG + Intronic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1140740325 16:77935972-77935994 AAAGAGAACGAGAGAGAAGCAGG - Intronic
1146432926 17:32815569-32815591 CAAATCTACGAGAGGGAAGAGGG - Intronic
1147178908 17:38673084-38673106 CAACGGTCCGAGATGGAAGGAGG + Exonic
1147424161 17:40337858-40337880 CCAGGGAAAGAGTGGGAAGCAGG - Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1150692797 17:67379063-67379085 GAAGGGGAAGAAAGGGAAGCCGG - Intronic
1151283377 17:73092693-73092715 CACGTGTGCGGGAGGGAAGCAGG - Intronic
1151850815 17:76688521-76688543 AAAGGGTGCAAGAGGAAAGCTGG + Intronic
1152107716 17:78340848-78340870 CAAGGGGGCAAGAGGGCAGCTGG + Intergenic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152418092 17:80175896-80175918 CAGGGATGAGAGAGGGAAGCAGG + Intronic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1156722475 18:40086928-40086950 CAAGGGAGCAGGAGGGAAGCAGG + Intergenic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1160855106 19:1213742-1213764 CAAGGATTCTAGAGGGACGCCGG - Intronic
1161346477 19:3770962-3770984 GGAGGGTGCGAGAGGGAAGGGGG + Intronic
1162200453 19:9016103-9016125 CAAGGGAATGACAGGGGAGCTGG + Intergenic
1164104576 19:22096719-22096741 CAAGGGTCTGAGAGGGAAATAGG - Intergenic
1164411469 19:28009372-28009394 CAAGGGAAGGAATGGGAAGCCGG + Intergenic
1164516459 19:28940555-28940577 CAAGGGAAGGAATGGGAAGCAGG + Intergenic
1164834470 19:31348963-31348985 AATGGGTGCGAGAGGGAAGAGGG + Intronic
1166617375 19:44262299-44262321 CAAGAGAAGGACAGGGAAGCTGG + Intronic
1167477986 19:49711976-49711998 AAAGGGTTAGAGAGGGAAGTGGG + Intronic
924979331 2:206963-206985 CATGGGAAAGAGAGGGAAACTGG + Intergenic
926049858 2:9737720-9737742 CAGGGGTACTAGAGGGAATGGGG - Intergenic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
929275223 2:40017973-40017995 CCAAGGTACGAGAGAGAAGGGGG + Intergenic
933699853 2:85246844-85246866 CAAGTGGACAAGAGGGAAGGAGG - Intronic
933835661 2:86243377-86243399 CAAGGGTCCAAGAGGAAAGAGGG - Intronic
934117976 2:88813791-88813813 CAAGGGAAGGAGAGGAGAGCTGG + Intergenic
936064721 2:109322071-109322093 AAAGGGTAAGGGAGAGAAGCGGG + Intronic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
936752245 2:115659109-115659131 CAAGAGTGAGAGAGGGAAGGAGG - Intronic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937366279 2:121264316-121264338 CCTGGGTATGAGAGAGAAGCAGG - Intronic
942350797 2:175050858-175050880 ACAGGGTACGAGAGGGAAACTGG + Intergenic
942787863 2:179720544-179720566 CAAGGGGAGGAGAGGGAGGGAGG + Intronic
943801130 2:192059390-192059412 CATGGGGATAAGAGGGAAGCTGG + Intronic
948916057 2:241035610-241035632 CTAGGCTACGAGAGGGGAGAGGG + Intronic
1170948857 20:20915948-20915970 CAAGGAAAAGAGAGAGAAGCAGG - Intergenic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1173925013 20:46774479-46774501 CAAGCGTGCCAGGGGGAAGCAGG + Intergenic
1174382077 20:50162397-50162419 CAAAGATAAGGGAGGGAAGCTGG + Intergenic
1174951829 20:55050793-55050815 GATGGGAAGGAGAGGGAAGCGGG + Intergenic
1178379596 21:32096695-32096717 GGAGGGAAGGAGAGGGAAGCGGG - Intergenic
1178908974 21:36659056-36659078 CAAGGGGAAGTGAGGCAAGCAGG - Intergenic
1180339313 22:11605644-11605666 CAAGGGTAGGCGAGTGAAGGTGG + Intergenic
1181291406 22:21796675-21796697 AAAGAGTAAGAGAGGGAAGGAGG + Intronic
1182350292 22:29695547-29695569 CCAGGGTCCGAGAGGCAGGCAGG + Exonic
1182756875 22:32687494-32687516 CAATGGAAAGAGAGGGAAACAGG - Intronic
1183326895 22:37199251-37199273 CCAGGGTTTGAGGGGGAAGCGGG - Intronic
1184227084 22:43135204-43135226 CAAGAATACCAAAGGGAAGCTGG + Intronic
951857612 3:27215055-27215077 CAGGGGTTGGAGCGGGAAGCCGG - Intronic
954264561 3:49462219-49462241 AAAGGGGATGAGAGGGAAGGGGG - Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957592541 3:82219099-82219121 CAAGGGTTTGAAAGGGAAGAAGG - Intergenic
959855650 3:111154174-111154196 CAAGGATATGAAAGAGAAGCTGG - Intronic
959858191 3:111186141-111186163 CAAGGATGTGACAGGGAAGCTGG + Intronic
960951296 3:123000265-123000287 CAAGGGCAGGAGAGAGGAGCTGG + Intronic
962645829 3:137439090-137439112 AAAGGGAAAGAGAGGGAAGGAGG - Intergenic
963945622 3:151143116-151143138 GCAGGGAATGAGAGGGAAGCCGG + Intronic
965387319 3:168060292-168060314 CATGGGTACAAGATGCAAGCAGG + Intronic
966169030 3:177056748-177056770 CAAGGGACCGAGAGAGAAGAGGG - Intronic
966325733 3:178751668-178751690 CAAAGGTACAATAGGGAAGAGGG + Intronic
967596788 3:191334695-191334717 GAAGGGGAAGAGAGGGAAGGAGG - Intronic
968477215 4:817710-817732 CAAGGGGGCGTGAGGGAAGGGGG - Intronic
968492382 4:896940-896962 CCAGGGTACGTGAGGGTATCTGG + Intronic
969515710 4:7647084-7647106 CCAGGGGACGAGAGGGAAGTAGG + Intronic
970709591 4:18846317-18846339 CAAGGGTAAGAGTAGGAAGATGG + Intergenic
973582634 4:52359186-52359208 CCAGGGTAGGAGAGGAAAACAGG + Intergenic
973626310 4:52776202-52776224 CAAGGGCAGGAGAAGGAAACAGG - Intergenic
977173532 4:93792241-93792263 AAAGGGTTAGAGAGGGAAGTGGG - Intergenic
978223697 4:106308605-106308627 GAAGTGTACGAGAGAGAGGCAGG + Intronic
985682331 5:1262969-1262991 TAAGGCTGTGAGAGGGAAGCAGG + Intronic
986169174 5:5301942-5301964 CAAGGGGATGAGAGGGGAGCTGG - Intronic
989735661 5:44701500-44701522 CAAGGGTAAGGGTGGGAAGAGGG - Intergenic
990352528 5:54933285-54933307 CAAGGGAAAGAGAGGAAGGCAGG - Intergenic
992227099 5:74629537-74629559 TGTGGGTCCGAGAGGGAAGCTGG - Exonic
992228910 5:74644135-74644157 GAAGGGGAAGGGAGGGAAGCAGG + Intronic
992399944 5:76403132-76403154 GAAGGGGCCGAGAGGGACGCTGG - Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
995010670 5:107254219-107254241 CAAGGGTCAGAAAGGGAAGCTGG + Intergenic
995879638 5:116829979-116830001 CAAGGATACGAGAGGGAAAGGGG + Intergenic
997612507 5:135224987-135225009 GAAGGGTACAAGAGGCAGGCTGG - Intronic
997656586 5:135559616-135559638 CACGGGGAAGAGAGGGATGCTGG + Intergenic
999512710 5:152269400-152269422 AAAGGGTAAGAGAGGCAAGAAGG - Intergenic
999806060 5:155082429-155082451 AAAGGGAACGAGAGGCAACCAGG - Intergenic
1001484686 5:172111150-172111172 CCAGGGTAAGAATGGGAAGCTGG + Intronic
1003232200 6:4264563-4264585 CACGGGTAGGAATGGGAAGCAGG - Intergenic
1003440658 6:6138371-6138393 CAAGGGCAGGAGAGGGAATGTGG + Intergenic
1004177731 6:13354734-13354756 CAAGGGAAGGAGAAGGGAGCAGG - Intergenic
1005691849 6:28314169-28314191 CAAGAGTTGGAGAGGGGAGCTGG + Intergenic
1005743441 6:28814245-28814267 AAAGAGTTCGAGAGGGAAGCAGG + Intergenic
1007264021 6:40584002-40584024 CAAGAGAAAGGGAGGGAAGCAGG + Intronic
1011202802 6:84855825-84855847 CAAGGGTTGGAGAGAGAAGTTGG + Intergenic
1019278231 7:187198-187220 CAAGGGTGGGAAAGGGATGCTGG - Intergenic
1019659546 7:2216358-2216380 CACGGCTAAGAGAAGGAAGCCGG + Intronic
1020273815 7:6613118-6613140 CAAGGGCAGGAGAGAGAAGTGGG + Intergenic
1022949534 7:35322684-35322706 GAAGGGCAGGAGTGGGAAGCAGG - Intergenic
1023979887 7:45062937-45062959 GAAGGGCAGGAGAGGGAAGGGGG + Intronic
1025110743 7:56214104-56214126 CAAGGGGAAGAGTGGGAAGGGGG - Intergenic
1026018670 7:66692316-66692338 CATGGGTAAGAGAGGGAGGCAGG - Intronic
1026881732 7:73910382-73910404 CATGGGTAAGAGAGGGAGGCAGG + Intergenic
1029556906 7:101276681-101276703 CAAGGGAACGAGCGGCAAACTGG + Intergenic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1045856362 8:106769784-106769806 CACAGGTACGAGAGGGATGCTGG - Exonic
1047139440 8:122120544-122120566 CATGGGTATGAGAAGGAATCAGG + Intergenic
1049027672 8:140006813-140006835 CTAGGGTGCGGGAGGGAAGTAGG + Intronic
1050770092 9:9187585-9187607 AGAGGGAAAGAGAGGGAAGCAGG - Intronic
1051806376 9:20997178-20997200 GATGGGAAGGAGAGGGAAGCTGG - Intergenic
1054944629 9:70783030-70783052 GATGGGTACGAGAGGGATGGAGG + Intronic
1055080336 9:72262347-72262369 GAAAGGTAGGAGAGGAAAGCAGG - Intergenic
1055170149 9:73247527-73247549 AAAGGGGATGAGAGAGAAGCAGG - Intergenic
1056557445 9:87701680-87701702 CAAAGGTAAGAGAGGGAGACAGG - Intronic
1057379626 9:94555939-94555961 GAAGAGAACGAGTGGGAAGCAGG + Intergenic
1058163466 9:101594950-101594972 AAAGGGTCGGAGAGGGGAGCAGG + Exonic
1058847326 9:108974088-108974110 CACGTGTAAGAGAGGGAGGCAGG + Intronic
1061342722 9:129996034-129996056 CAAGGGTATGAGGGGGAGGGAGG + Intronic
1061369574 9:130190891-130190913 CAAGGGGCTGAGAGGGAAACGGG + Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1188284860 X:28315217-28315239 CCAAGGAAGGAGAGGGAAGCAGG + Intergenic
1190787577 X:53666636-53666658 CACTGGTAAGAGAGGTAAGCAGG - Intronic
1194193045 X:90860431-90860453 CAAAGGCATGAGAGGTAAGCAGG - Intergenic
1195523533 X:105858693-105858715 GAAGGGTAGGAGGGGGAAGTAGG + Intronic
1195890601 X:109689318-109689340 TAGGGGTATGAGATGGAAGCAGG - Intronic
1196083743 X:111661422-111661444 CAAGAGGAAGAGAGGGAAGGGGG - Intergenic
1197823276 X:130563130-130563152 GAAGGGAAGGAAAGGGAAGCGGG + Intergenic
1198311103 X:135426257-135426279 CAAGGTTGGGAAAGGGAAGCAGG - Intergenic
1199109280 X:143910932-143910954 CAAGGGAAAGAGAGAGAAGGAGG + Intergenic
1199816892 X:151405710-151405732 CAAGGGGACTTGAAGGAAGCAGG - Exonic
1200539663 Y:4442881-4442903 CAAAGGCATGAGAGGTAAGCAGG - Intergenic