ID: 1139959917

View in Genome Browser
Species Human (GRCh38)
Location 16:70711523-70711545
Sequence CTGTTTGAACAGAGGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 245}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139959917_1139959922 2 Left 1139959917 16:70711523-70711545 CCTGGCCTCCTCTGTTCAAACAG 0: 1
1: 0
2: 1
3: 26
4: 245
Right 1139959922 16:70711548-70711570 AGATAAAGAGGTCAGCTCTTGGG 0: 1
1: 0
2: 0
3: 19
4: 197
1139959917_1139959923 18 Left 1139959917 16:70711523-70711545 CCTGGCCTCCTCTGTTCAAACAG 0: 1
1: 0
2: 1
3: 26
4: 245
Right 1139959923 16:70711564-70711586 TCTTGGGCAAGACCTGTGCTTGG 0: 1
1: 0
2: 2
3: 20
4: 188
1139959917_1139959924 29 Left 1139959917 16:70711523-70711545 CCTGGCCTCCTCTGTTCAAACAG 0: 1
1: 0
2: 1
3: 26
4: 245
Right 1139959924 16:70711575-70711597 ACCTGTGCTTGGACTCTCCCTGG 0: 1
1: 0
2: 2
3: 12
4: 184
1139959917_1139959921 1 Left 1139959917 16:70711523-70711545 CCTGGCCTCCTCTGTTCAAACAG 0: 1
1: 0
2: 1
3: 26
4: 245
Right 1139959921 16:70711547-70711569 AAGATAAAGAGGTCAGCTCTTGG 0: 1
1: 0
2: 2
3: 23
4: 243
1139959917_1139959920 -10 Left 1139959917 16:70711523-70711545 CCTGGCCTCCTCTGTTCAAACAG 0: 1
1: 0
2: 1
3: 26
4: 245
Right 1139959920 16:70711536-70711558 GTTCAAACAGAAAGATAAAGAGG 0: 1
1: 0
2: 4
3: 49
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139959917 Original CRISPR CTGTTTGAACAGAGGAGGCC AGG (reversed) Intronic
900273481 1:1807377-1807399 CTGCTTGAACCCAGGAGGCGGGG + Intronic
901522725 1:9797703-9797725 CTGAAGGAACAGAGGAGGCTTGG + Intronic
905386702 1:37609442-37609464 CTGGTTGAAGAGAGGAGTCTGGG - Intergenic
906214983 1:44033407-44033429 CTGTTAGAAGAGAGGAGGATGGG + Intergenic
906597421 1:47091885-47091907 CTGTGGGAAGAGGGGAGGCCTGG + Intronic
906901523 1:49841998-49842020 CTGGGTGCAAAGAGGAGGCCGGG - Intronic
908241685 1:62194087-62194109 TTGCTTGAACCCAGGAGGCCGGG + Intergenic
908705830 1:66953686-66953708 CTGCTTGAACCCAGGAGGCAGGG - Intronic
909238256 1:73180485-73180507 CAGTTAGCAGAGAGGAGGCCTGG + Intergenic
909882134 1:80892739-80892761 CTGTCTGAACAGAGAATGCAAGG + Intergenic
910213065 1:84813800-84813822 CTCTTTTCCCAGAGGAGGCCTGG + Exonic
910546980 1:88429311-88429333 TTGTTTGAACCCAGGAGGCGGGG + Intergenic
912449680 1:109761273-109761295 CAGATTGAACAGAGCAGGCCTGG - Intronic
914753504 1:150550680-150550702 CTGACTGAACGGGGGAGGCCAGG - Intronic
914920066 1:151840306-151840328 CAGCTTCAGCAGAGGAGGCCTGG - Exonic
915204104 1:154256552-154256574 CTGTTTGAGCCCAGGAGGCCAGG + Intronic
920074246 1:203325316-203325338 CTGTGTGACCAAAGGAGGCGGGG - Intergenic
921925551 1:220707468-220707490 GATTTTGAACAGAGGAGGGCAGG + Intergenic
922577023 1:226667600-226667622 CTGATTGGACAAAGGAGTCCAGG - Intronic
923376367 1:233367773-233367795 CTGTTTGAACTCAAGAGGCAAGG + Intronic
924391717 1:243567546-243567568 CTGTTTGAACTCAGGAGTTCGGG - Intronic
1063636190 10:7785469-7785491 CTTGTTGAAGAGAGGAGGCCAGG - Intronic
1064760280 10:18611864-18611886 CTGTTAGAACTGAGGGCGCCAGG - Intronic
1065783755 10:29194063-29194085 CTCTTTGAAAAAATGAGGCCGGG + Intergenic
1066118197 10:32258645-32258667 CAGTTTTACAAGAGGAGGCCAGG - Intergenic
1067066924 10:43109375-43109397 CTGTGTGCACAGAAGAGGCCTGG + Intronic
1067355944 10:45526536-45526558 CAGGCTGAAGAGAGGAGGCCAGG + Intronic
1069758474 10:70789869-70789891 ATATTAGAATAGAGGAGGCCAGG - Intergenic
1070722046 10:78763769-78763791 CTGGTGGGTCAGAGGAGGCCAGG + Intergenic
1071223789 10:83501484-83501506 CTGTCTAAACGGAGGAGGGCTGG - Intergenic
1071672351 10:87620532-87620554 CTGGTTGATCAGAGGAAGCTCGG + Intergenic
1072345742 10:94503707-94503729 CTGCTTGAACCCAGGAGGCAGGG - Intronic
1072736288 10:97881785-97881807 CTGTCTGAACAAAGGAGCACAGG - Intronic
1072913133 10:99521303-99521325 CAGTTTGAAAAGACTAGGCCTGG - Intergenic
1073456168 10:103637996-103638018 CTTTCTGACCAGGGGAGGCCTGG - Intronic
1076621716 10:131793154-131793176 CTGTTGGATCAGAGGAGGCTTGG + Intergenic
1076984862 11:228107-228129 CTGTAGGAACAGAGTAGGCTGGG - Intronic
1077069109 11:659786-659808 CTGTCTCTCCAGAGGAGGCCGGG - Intronic
1077222743 11:1424718-1424740 CTGTTTGGACAGAGGGAGTCGGG + Intronic
1077482918 11:2824954-2824976 GCGTTTGGACAGGGGAGGCCGGG + Intronic
1078909040 11:15713853-15713875 TTGTTTGAACCCAGGAGGCGAGG - Intergenic
1081616441 11:44594290-44594312 CTGTTTGAAGTCAGGGGGCCGGG - Intronic
1081734883 11:45395667-45395689 CTGTTTGTAGGGAGCAGGCCGGG + Intergenic
1082819786 11:57537227-57537249 CTGGATGAGCAGTGGAGGCCAGG + Intergenic
1083096169 11:60253735-60253757 CTCTTCTTACAGAGGAGGCCTGG + Intergenic
1084319867 11:68367287-68367309 CTTTGTTTACAGAGGAGGCCAGG + Intronic
1084960233 11:72712635-72712657 CTGTGTGGACAGAGGGGGCGTGG - Intronic
1085258893 11:75193130-75193152 CTGCTTGAACTGAGCAGGGCAGG + Intronic
1086145705 11:83549118-83549140 CTGCTTGATTAGAGGAGACCTGG + Intronic
1087954347 11:104266521-104266543 CTGTTTGAGCAAAAGAAGCCAGG - Intergenic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1088738022 11:112744570-112744592 GTGTTTGGACAGTGGAGGCAGGG + Intergenic
1089477036 11:118772847-118772869 CTGTTGGGACAGGGGAGACCAGG - Intronic
1089510791 11:118995824-118995846 CTGCTTGAACCCAGGAGGCGGGG - Intergenic
1090296778 11:125595181-125595203 CTTTTTAAAGAGAGGAGGTCTGG + Intronic
1091653293 12:2325384-2325406 GTGTTTTAACAGAGGACTCCTGG + Intronic
1091791603 12:3275117-3275139 CAGTTTGAAGAGAGGTGACCAGG + Intronic
1093064629 12:14644182-14644204 CTGTTTCAAAAGGGGAAGCCTGG + Intronic
1095531421 12:43190684-43190706 CCCTTTGACCAGAGGAAGCCCGG - Intergenic
1096722770 12:53536359-53536381 TTGCTTGAACCCAGGAGGCCAGG - Intronic
1096767162 12:53900944-53900966 GTGTTTGAACAGAGGTGGAGAGG - Intergenic
1099033834 12:77560714-77560736 CAGTTTCCACAGAGGGGGCCAGG - Intergenic
1099131010 12:78831115-78831137 TTGCTTGAACCGAGGAGGCAGGG + Intergenic
1099256812 12:80324619-80324641 CTGTTGGAGGAGAGGAGGACAGG + Intronic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100467817 12:94863204-94863226 CTGTTTGAGCAGAAGAGACCAGG + Intergenic
1101366131 12:104072285-104072307 TTGCTTGAGCACAGGAGGCCAGG + Intronic
1104102217 12:125623553-125623575 CTGTTGGAACAGAGATGTCCTGG + Intronic
1104688698 12:130807866-130807888 CTGTTTGAGAAGAGGAGGGAGGG - Intronic
1106296368 13:28417709-28417731 TTGTTTGAACCCAGGAGCCCTGG - Intronic
1107120099 13:36786933-36786955 CTGTTTAACCACAGGAAGCCTGG + Intergenic
1108039278 13:46324354-46324376 CTGATAGAAAAGAGGAGGCGGGG + Intergenic
1108949550 13:56073537-56073559 GTGGTTGAACAGAGGAGGACAGG - Intergenic
1109696832 13:65972006-65972028 CTGCTTGAACCCAGGAGGCGGGG - Intergenic
1110316266 13:74111066-74111088 CTGCTTGAACCCAGGAGGCAGGG + Intronic
1112688714 13:101863943-101863965 CTGCTGGCACAGAGGAGGGCAGG + Intronic
1113802238 13:113092659-113092681 CTGTGTGAAGGCAGGAGGCCGGG - Intronic
1114510594 14:23256665-23256687 AAATTTGAATAGAGGAGGCCAGG - Intronic
1115627290 14:35206479-35206501 GGGTTTGAACAGAGTAGACCTGG - Intronic
1120510861 14:85412650-85412672 CTGCTTGAACCCAGGAGGCAGGG + Intergenic
1122141665 14:99666612-99666634 GGGTTGGAACAGAGGAGACCAGG + Intronic
1125789663 15:42354635-42354657 CTGTTCCAACAGAGGAGGTAAGG - Exonic
1126787076 15:52186072-52186094 CAGTTTCAAGAGATGAGGCCAGG - Intronic
1128268194 15:66285608-66285630 CTCTTTCATCAGAGGAAGCCAGG - Intergenic
1129519741 15:76178142-76178164 CTGCTGGGACAGAGGAAGCCTGG + Intronic
1130323951 15:82863717-82863739 CTGTCTTAACAGAGGAGATCCGG - Intronic
1130730672 15:86488700-86488722 CTGTTTGAAGCAAGGAGGACAGG - Intronic
1130959489 15:88650287-88650309 CTGTGTGACCAGAGCAGGGCAGG + Intronic
1133963845 16:10517291-10517313 TTGTTTGAACCCAGGAGGCGGGG - Intergenic
1137314322 16:47300186-47300208 CTATTTGACCAGAGTGGGCCAGG - Intronic
1139385743 16:66568589-66568611 ATATTTGAAAAGAGGTGGCCAGG + Intronic
1139959917 16:70711523-70711545 CTGTTTGAACAGAGGAGGCCAGG - Intronic
1140774190 16:78235195-78235217 CTGTTTGAAGAAAGGAAGCATGG - Intronic
1141690299 16:85592958-85592980 CTGGCTGAACAGAGGTGGCGGGG - Intergenic
1142403127 16:89871460-89871482 CTGCGTGGACAGAGCAGGCCTGG - Intergenic
1142581799 17:947646-947668 CTGCTTGAACGCAGGAGGCAGGG + Intronic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1143756768 17:9073121-9073143 CACTTTGCACAGCGGAGGCCCGG + Intronic
1144712053 17:17407724-17407746 ATGTGTGAGCAGAAGAGGCCAGG - Intergenic
1146023534 17:29299468-29299490 CTGCTTGAACCTAGGAGGCCGGG - Intergenic
1147586832 17:41657717-41657739 TTGCTTGAACAGAGGTGGTCCGG - Intergenic
1148923248 17:51059254-51059276 GTGTTTGAACTGAGGTGGGCTGG - Intronic
1149507061 17:57203268-57203290 CTGTACTTACAGAGGAGGCCTGG + Intergenic
1150968622 17:70000826-70000848 TTGCTTGAACACAGGAGGCGGGG + Intergenic
1151664629 17:75538497-75538519 ATGAATGAACAGAGGAGGCGAGG - Intronic
1153807504 18:8721937-8721959 CTGTGTGATCAGAGCATGCCTGG + Intronic
1157670023 18:49520396-49520418 CTGCTTGAACCCAGGAGGCAGGG - Intergenic
1157843858 18:50984152-50984174 CTGATTGTGCAGAGGAGCCCAGG - Exonic
1158007206 18:52686323-52686345 CTGTTGGAACAGAGGTAGGCTGG - Intronic
1161226384 19:3148478-3148500 GGGTTTGAACCCAGGAGGCCTGG + Intronic
1161495089 19:4581985-4582007 GAGTTTGAACAGAGGGGACCAGG - Intergenic
1161509287 19:4661768-4661790 CTGTCTGAGATGAGGAGGCCTGG + Intronic
1161644578 19:5445090-5445112 CTGCTTGAACTCAGGAGGCAGGG + Intergenic
1162119078 19:8450989-8451011 TTGCTTGAACACAGGAGGCGGGG - Intronic
1162175789 19:8829172-8829194 CTGCTTGAACCCGGGAGGCCGGG + Intronic
1162777239 19:12987340-12987362 CTGTGGGAACAGAGGAGGAGAGG + Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163773458 19:19204480-19204502 TTGTTGGGACAGAGGAGCCCTGG + Intergenic
1164846395 19:31436695-31436717 CTGTATGCACAGAAGAGACCAGG - Intergenic
1164867596 19:31617665-31617687 CTGGTTGTACAGATGAGGACAGG + Intergenic
1165315429 19:35052441-35052463 CTGTTTGAACCTGGGAGGCGCGG + Intronic
1165703293 19:37955000-37955022 TTGCTTGAACACAGGAGGCGGGG + Intronic
1166187562 19:41151328-41151350 TTGTTTGAACCCAGGAGGCAGGG + Intergenic
1166301522 19:41914204-41914226 GTGTGGGAACAGAGGGGGCCTGG - Intronic
1166473712 19:43102377-43102399 CTATGGGAAGAGAGGAGGCCTGG + Intronic
1167419842 19:49396337-49396359 CTGCTTGAACCCAGGAGGCGGGG - Intronic
1167765567 19:51480016-51480038 GTGTTTGAGCAGAGGAGAACAGG + Intronic
1168087725 19:54060660-54060682 CTGTTTGAACAGACGATGGGTGG - Intronic
1168112595 19:54202104-54202126 TTGTTTGAACCCAGGAGGCGGGG - Intronic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
1168618867 19:57860703-57860725 CTTTTTGTAGAGAGGAGGTCTGG - Exonic
1168645632 19:58057208-58057230 CTCTTGGGTCAGAGGAGGCCTGG + Intergenic
925225957 2:2184595-2184617 TTGTTTGGACAGAGGAGGTTGGG - Intronic
927136281 2:20098783-20098805 TTGTTTGAACCCAGGAGGCAGGG - Intergenic
927795833 2:26047806-26047828 TCGTTTGAACACAGGAGGCAGGG - Intronic
928561836 2:32496517-32496539 CTGTATGAACAAATGAGGCTGGG - Intronic
930881600 2:56276885-56276907 CTGCTGGAACAGACGATGCCTGG - Intronic
931678342 2:64720458-64720480 CTGCTTGAACCCAGGAGGCAGGG + Intronic
933758607 2:85659800-85659822 CTGTTTCAGCAGGGAAGGCCGGG + Intronic
940464358 2:154009573-154009595 CTGGTTGAACCCAGGAGGCAGGG - Intronic
941592530 2:167437642-167437664 CTGTTTGAACAGATGAGCCAGGG - Intergenic
941624341 2:167814369-167814391 TTGGTAGAACAGAGGAGGCTTGG + Intergenic
941645271 2:168033616-168033638 TTATTTGAACAGAGAAGGCAGGG + Intronic
941772201 2:169357414-169357436 CTGCTTGAACACAGGAGGCAGGG - Intronic
941927087 2:170906697-170906719 CCTTGTGAACAGATGAGGCCAGG + Intergenic
941948224 2:171123496-171123518 CAGTATTAACAGATGAGGCCAGG - Intronic
942024424 2:171898327-171898349 CTGCTTGAACCCAGGAGGTCGGG - Intronic
943269166 2:185775746-185775768 CTGCTTGAACCCAGGAGGCAGGG - Intronic
943725450 2:191246871-191246893 GGGTTTGAACTGAGGAGCCCTGG + Intronic
944800988 2:203238133-203238155 CTGTTTGAACAGAGCCCTCCCGG - Intergenic
947752773 2:232541351-232541373 CTGTATGCACAGAACAGGCCAGG - Intronic
948016394 2:234694334-234694356 CAGTTTGCACAGAGCAGTCCTGG + Intergenic
1169016986 20:2300020-2300042 CTGCTTGAACCCAGGAGGCAGGG + Intronic
1170341227 20:15329516-15329538 CTGTTTGAACCCAGGAGCTCAGG + Intronic
1170436694 20:16337874-16337896 CTGTTTGCACAGAAAAGCCCAGG + Intronic
1171371719 20:24666677-24666699 CTATTTCAGCAGTGGAGGCCTGG - Intergenic
1172947982 20:38703288-38703310 GTCTTTGAGCAGGGGAGGCCAGG + Intergenic
1173459846 20:43234402-43234424 TTGTTTGAACACAGGAGGCGGGG - Intergenic
1173905924 20:46628661-46628683 CTGTCTAAACAGTGGAGCCCTGG + Intronic
1175167681 20:57056738-57056760 CTGTTTGGAAAGAGGTGGCTGGG - Intergenic
1175887301 20:62299508-62299530 CTGCTTGAACTCAGGAGGCGGGG + Intergenic
1177035745 21:16040393-16040415 CTGTTTGAGCAGACTAGGCATGG + Intergenic
1177163230 21:17572049-17572071 CTTTTTGAAGAGACCAGGCCAGG - Intronic
1177357790 21:20031449-20031471 CTCTTAGAAGAGAGGAGACCTGG + Intergenic
1179046763 21:37851543-37851565 CTGTTTGGATAGAGGAGGGAAGG + Intronic
1181452702 22:23034531-23034553 CTCTTTGGAAAGAGGAGGGCTGG + Intergenic
1183099231 22:35573737-35573759 CTGTGTGAACAGAGGGGGCTGGG + Intergenic
1183675162 22:39295058-39295080 CTGTTGGGAGGGAGGAGGCCTGG - Intergenic
1184886943 22:47352252-47352274 GTGTTTCCACAGATGAGGCCAGG - Intergenic
950103973 3:10376838-10376860 AGGTTTGAGCAGAGGAGGGCAGG + Intronic
950224650 3:11223782-11223804 CTTGTTTAACAGAGGAGGCCTGG + Intronic
950770615 3:15307886-15307908 CTCATTTAACAGAGTAGGCCTGG - Intronic
951081602 3:18456390-18456412 CTGTGTGAACTGAGGAGGCAGGG - Intergenic
951682513 3:25309432-25309454 TTGTAAGAATAGAGGAGGCCGGG - Intronic
955185114 3:56708016-56708038 CTGCTTGAACCCAGGAGGCAGGG - Intergenic
957562813 3:81845607-81845629 CTCTTTTAACAGAGGTGGCCCGG - Intergenic
960437826 3:117648734-117648756 CTGTTAGAAGAGAGGAGCCCTGG + Intergenic
960572156 3:119195962-119195984 TTGTTAGAACAGATGAGGCCAGG - Intronic
961142515 3:124567240-124567262 CTCTTGGAAGAGAGGAGACCGGG - Intronic
965614091 3:170575356-170575378 CAGTTTGAAATGAGGAGGCAGGG + Intronic
965819736 3:172673109-172673131 CTATAGGAAGAGAGGAGGCCTGG - Intronic
966224388 3:177582312-177582334 CTCTTTGCACAGAGGAGGCAGGG + Intergenic
967803477 3:193690916-193690938 GTGTTTTAAAATAGGAGGCCAGG + Intronic
968882285 4:3307377-3307399 GGGTCTGAAGAGAGGAGGCCAGG + Intronic
969317778 4:6392453-6392475 CTGTTTTAGCTGGGGAGGCCAGG + Intronic
969459627 4:7322140-7322162 CTGCTTGACCAGAGGGGGCCGGG + Intronic
972159118 4:36200548-36200570 GTGCTAGAAAAGAGGAGGCCGGG - Intronic
972260809 4:37406809-37406831 TTGTTTGAACCCAGGAGGCAGGG + Intronic
972639727 4:40914465-40914487 CTGCTTGAACCCAGGAGGCGGGG + Intronic
972698464 4:41470696-41470718 ATGTTTGAAGAGAAGAGGCGTGG - Intronic
974061731 4:57041846-57041868 ACCTTTGAACAGAAGAGGCCCGG + Intronic
974419290 4:61651690-61651712 TTGCTTGAACACAGGAGGCGGGG - Intronic
975444670 4:74448662-74448684 CTATTTGAAAACAGGAGCCCAGG - Intronic
977730239 4:100342280-100342302 CTGTTTGCACACATCAGGCCAGG + Intergenic
978285812 4:107074995-107075017 GTGTTTGAATACAGGTGGCCTGG + Intronic
980080322 4:128337469-128337491 CTGCTTGAACGCAGGAGGCAGGG - Intergenic
980963479 4:139498975-139498997 TTGTTTGAACCCAGGAGGCAGGG + Intronic
981493358 4:145364963-145364985 CTCTTTGAACAGGAGAGGACGGG + Intergenic
981697806 4:147576258-147576280 CTGTTTGAGCCTTGGAGGCCGGG - Intergenic
982090367 4:151875259-151875281 CTGCATGAACAGGGGAGGCATGG + Intergenic
982205060 4:152991539-152991561 CTGTTAGAAGTCAGGAGGCCAGG + Intergenic
984091340 4:175378832-175378854 CTGCTTGAACACAGGAGTTCTGG - Intergenic
985166997 4:187107255-187107277 GGATTTGAACAGAGGAGGCAGGG - Intergenic
985952816 5:3236460-3236482 CTCTTTGAACAGAGGAGGCAAGG - Intergenic
990065304 5:51705802-51705824 TTGTTTGAACCCAGGAGGCGGGG + Intergenic
991728860 5:69563032-69563054 CTGCTTGAACCCAGGAGGCACGG - Intronic
991805289 5:70418181-70418203 CTGCTTGAACCCAGGAGGCACGG - Intergenic
991866095 5:71064841-71064863 CTGCTTGAACCCAGGAGGCACGG + Intronic
992903957 5:81326704-81326726 CTCTCTGGGCAGAGGAGGCCTGG - Intergenic
994689172 5:102995465-102995487 TTTTTTGAAGATAGGAGGCCTGG + Intronic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
995140636 5:108731861-108731883 CTGCTTGAACCCAGGAGGCAGGG - Intergenic
995420790 5:111964449-111964471 TTGCTTGAACACAGGAGGCGAGG - Intronic
997211567 5:132079951-132079973 CTGTTGGTCCAGAGGAAGCCAGG - Intergenic
997774509 5:136588869-136588891 CTGTTGGAACAGAGTGGGGCAGG + Intergenic
998092863 5:139381200-139381222 CTGTTTGAGCAGCGGGGGACAGG - Intronic
1000312407 5:160057850-160057872 TTGTTTGAACCCAGGAGGCGGGG - Intronic
1001530429 5:172457552-172457574 CTGCTTGAACCCAGGAGGCAGGG - Intergenic
1002432325 5:179210765-179210787 TTGTTGGGACAGAGGAGGACAGG - Intronic
1002543219 5:179920036-179920058 CTGTTTCCAGAGAAGAGGCCGGG - Intronic
1005946347 6:30598750-30598772 CTGGTTTAAGAGTGGAGGCCAGG + Intergenic
1006163490 6:32050995-32051017 GTGTGGGAGCAGAGGAGGCCTGG - Intronic
1009842519 6:69094070-69094092 CTGTTTGCACAGTGGAGGCAAGG + Intronic
1010736101 6:79445004-79445026 CTGTGTGAACATTGCAGGCCTGG + Intergenic
1015423836 6:133041279-133041301 CTGTGTGCACAGGGTAGGCCAGG - Intergenic
1016507847 6:144804519-144804541 CTGTTTGTACAGAGGTGACTGGG + Intronic
1017508367 6:155089500-155089522 CTTATTAAACAGATGAGGCCAGG - Intronic
1020051003 7:5081578-5081600 TTGTTTGAACACAGGAGGTCGGG + Intergenic
1022445788 7:30469700-30469722 CTGTTTGACCTCAGGAGCCCAGG - Intronic
1023878063 7:44301479-44301501 CATTTTGAAAAGAAGAGGCCGGG + Intronic
1023886747 7:44362904-44362926 CTATCAGAACAGATGAGGCCAGG + Intergenic
1024119852 7:46225717-46225739 CTGTTTGGACAGAAGAGAGCAGG + Intergenic
1024251113 7:47506369-47506391 CTCTATGACCAAAGGAGGCCTGG - Intronic
1030041296 7:105452728-105452750 TTGTTTGAACCCAGGAGGCAGGG + Intronic
1031181853 7:118429432-118429454 CTCTTTGAACATAGGAAGCTTGG - Intergenic
1031693242 7:124816906-124816928 ATGTTGGAACAGAGGATGTCAGG + Intergenic
1033816925 7:145084677-145084699 CTCTTTGAACAGAAGTGGGCAGG - Intergenic
1034406373 7:150905522-150905544 CTCTCTCAGCAGAGGAGGCCTGG + Intergenic
1034468087 7:151241636-151241658 CAGTTTGAACTGGGGAGGCTGGG + Exonic
1034585071 7:152083573-152083595 CTGTTTGGATAGAGAAGCCCTGG + Intronic
1035103905 7:156425853-156425875 CTGTTGGAACAGAGGAAGTTTGG - Intergenic
1036179015 8:6567404-6567426 CCGTGTGAACAGGGGAGGACTGG + Intronic
1037422619 8:18719931-18719953 CGCTATGAACAGAAGAGGCCTGG - Intronic
1037811867 8:22091200-22091222 CTGTTAGATCAGAAGAGGGCGGG - Intronic
1038665865 8:29537404-29537426 TTGCTTGAACTCAGGAGGCCAGG - Intergenic
1039741583 8:40387907-40387929 CTGGCTGAACAGAGGAGGTGGGG - Intergenic
1046212605 8:111097820-111097842 ATGCTTGAACCGAGGAGGCCGGG + Intergenic
1048307210 8:133292731-133292753 CTGTTTGAAGAGAGGTGGGTGGG - Intronic
1048391172 8:133966162-133966184 CTGTTTGGAGAGATGAGGACAGG - Intergenic
1049685056 8:143936056-143936078 CTGTGGGCACAGAGCAGGCCTGG - Intronic
1050762410 9:9088493-9088515 TTGTTTGAACCCAGGAGGTCGGG + Intronic
1051622856 9:19069610-19069632 CTATTTGAACCCAGGAGGCGGGG + Intronic
1053567845 9:39271605-39271627 CTGTGGGAACAGATGAGGCCTGG + Intronic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054129298 9:61347394-61347416 CTGTGGGAACAGATGAGGCCTGG - Intergenic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1054976555 9:71153373-71153395 CTGCTTGAACCCAGGAGGCTAGG - Intronic
1055366586 9:75550634-75550656 CTGCTTGAACCCAGAAGGCCAGG - Intergenic
1056069318 9:82969456-82969478 CAGTCTGAAGACAGGAGGCCTGG + Intergenic
1057589664 9:96361389-96361411 CTATATGAAGAGAAGAGGCCAGG + Intronic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1059660263 9:116393147-116393169 CTGATTGAACTGGGGAGGACAGG + Intronic
1061557764 9:131382440-131382462 TGGTTTGAAGAGAGGATGCCAGG + Intergenic
1061952553 9:133944434-133944456 CAGTTTGAACACAGGTGGCTTGG + Intronic
1062050169 9:134443074-134443096 CTGGGTGACCAGAGGAGGCCAGG + Intergenic
1185656205 X:1687774-1687796 TTGCTTGAACCCAGGAGGCCAGG + Intergenic
1189468726 X:41297949-41297971 CTGCTTGAACCCAGGAGGCAGGG + Intergenic
1192632913 X:72790844-72790866 CTGTTTTACCAGGAGAGGCCTGG - Intronic
1192648796 X:72929957-72929979 CTGTTTTACCAGGAGAGGCCTGG + Intronic
1198639246 X:138738499-138738521 CTCTTTGAAAAGAGCAGGACAGG - Intronic
1200110594 X:153738849-153738871 CTGTGTGCAGGGAGGAGGCCAGG - Intronic
1200132250 X:153856984-153857006 CTCTTCAAACAGAGGAGGCTGGG - Intergenic
1201382754 Y:13401789-13401811 TTGTTTGAACCCAGGAGGCAAGG + Intronic