ID: 1139962230

View in Genome Browser
Species Human (GRCh38)
Location 16:70724597-70724619
Sequence CTAATTAGGAGATGAGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139962220_1139962230 6 Left 1139962220 16:70724568-70724590 CCCCTGCCATTCCCATTGCGAAG 0: 1
1: 0
2: 3
3: 17
4: 166
Right 1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 164
1139962219_1139962230 7 Left 1139962219 16:70724567-70724589 CCCCCTGCCATTCCCATTGCGAA 0: 1
1: 0
2: 2
3: 12
4: 132
Right 1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 164
1139962226_1139962230 0 Left 1139962226 16:70724574-70724596 CCATTCCCATTGCGAAGGGGTCT 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 164
1139962228_1139962230 -6 Left 1139962228 16:70724580-70724602 CCATTGCGAAGGGGTCTCTAATT 0: 1
1: 0
2: 1
3: 4
4: 46
Right 1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 164
1139962221_1139962230 5 Left 1139962221 16:70724569-70724591 CCCTGCCATTCCCATTGCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 164
1139962227_1139962230 -5 Left 1139962227 16:70724579-70724601 CCCATTGCGAAGGGGTCTCTAAT 0: 1
1: 0
2: 1
3: 4
4: 33
Right 1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 164
1139962216_1139962230 26 Left 1139962216 16:70724548-70724570 CCTCTTGGGCCTCCTGGGTCCCC 0: 1
1: 2
2: 8
3: 47
4: 457
Right 1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 164
1139962217_1139962230 17 Left 1139962217 16:70724557-70724579 CCTCCTGGGTCCCCCTGCCATTC 0: 1
1: 0
2: 8
3: 42
4: 320
Right 1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 164
1139962223_1139962230 4 Left 1139962223 16:70724570-70724592 CCTGCCATTCCCATTGCGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 89
Right 1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 164
1139962218_1139962230 14 Left 1139962218 16:70724560-70724582 CCTGGGTCCCCCTGCCATTCCCA 0: 1
1: 1
2: 2
3: 46
4: 440
Right 1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139962230 Original CRISPR CTAATTAGGAGATGAGAAGC CGG Intronic
901029290 1:6297521-6297543 CTAGGTAGGAGCTGAGCAGCAGG - Intronic
902070047 1:13726566-13726588 TTAATTGGGGGAAGAGAAGCGGG + Intronic
907270617 1:53288804-53288826 TTAAAAAGGAGATGAGAAGGGGG - Intronic
908949929 1:69548080-69548102 CACAGTAGGAGATGAGCAGCAGG + Intergenic
909497737 1:76298186-76298208 CTAAGTAGGAAATGACAAGCTGG + Intronic
911806750 1:102219925-102219947 CTAATTGAGAGATGAGCAGATGG + Intergenic
912321220 1:108715414-108715436 CCCTTTAGTAGATGAGAAGCTGG - Intronic
912928336 1:113932686-113932708 CTAATTCCGAGATGAGAAAAAGG - Intronic
915090454 1:153420597-153420619 CTGATAAGGAGAGGAGATGCTGG - Exonic
915095034 1:153456496-153456518 CTGATGAGGAGAGGAGATGCTGG + Intergenic
917227296 1:172799022-172799044 CTGATTATGAGAGGTGAAGCTGG + Intergenic
919261042 1:195194429-195194451 AGAATTAGGAGAAGAGAAGTGGG - Intergenic
922588208 1:226751796-226751818 CTAAGTTGGAGCTGAGAAGCTGG + Intergenic
923889379 1:238195147-238195169 CTAATCAGGTGATGAGAAACAGG + Intergenic
1064820360 10:19323234-19323256 ATAAGTAGGAGATGAAAAACAGG - Intronic
1068602418 10:58969698-58969720 CTGATAAGGAGCTGAGAAGAGGG + Intergenic
1069742625 10:70695257-70695279 CTTATCAGGAGAGGAGAGGCCGG + Intronic
1075239248 10:120763103-120763125 GTAATTAGGACTTGAGAAACTGG + Intergenic
1077790059 11:5429556-5429578 GTGTTTAGGAGATGAGAAGATGG + Intronic
1079674514 11:23208886-23208908 CAAAGCAGGAGATGAGCAGCAGG - Intergenic
1080105790 11:28510903-28510925 CTAATTTGGAAATGACAAGTTGG + Intergenic
1081527874 11:43939259-43939281 CATATTAGAGGATGAGAAGCTGG - Intronic
1082628254 11:55510368-55510390 CTATGTAGGAGATGACGAGCAGG - Intergenic
1088544116 11:110942677-110942699 GCATTTGGGAGATGAGAAGCTGG + Intergenic
1090275042 11:125413184-125413206 CTAATTTGGAGAGGAGGGGCTGG + Intronic
1092830456 12:12439521-12439543 CTACTTGGGAGGTGAGAAGATGG + Intronic
1093748765 12:22774152-22774174 ATACTTAAAAGATGAGAAGCAGG - Intergenic
1096096263 12:48937746-48937768 CTAATGAGGAGCTGGGAAGTGGG - Exonic
1100910290 12:99353074-99353096 CTAATTAGGAGAAGGGTAACCGG - Intronic
1101548800 12:105742394-105742416 CTCAGTAGGAAATGAGGAGCTGG + Intergenic
1104908626 12:132228877-132228899 CTCATTAGAAGATGAGCAGCTGG + Intronic
1105200908 13:18176053-18176075 CTATTTAGAAAATGAGATGCAGG - Intergenic
1105407664 13:20145366-20145388 CACAATAGGAGATGAGAGGCTGG - Intronic
1106525389 13:30536334-30536356 GAAATTAGGAGAGGAGAAGGGGG - Intronic
1106788256 13:33129084-33129106 CTGATTAGGAGATGGAAAGGTGG + Exonic
1107832632 13:44387897-44387919 CTAATTAGGAAATGAATATCAGG - Intronic
1108205054 13:48079929-48079951 CTGATTTAGAGATGAGAAGTGGG - Exonic
1108556540 13:51598808-51598830 CCAATTAGAAGAGGTGAAGCAGG + Intronic
1108707625 13:53003971-53003993 TTAATTCTGAGGTGAGAAGCAGG + Intergenic
1108731471 13:53239776-53239798 CTTTTTAACAGATGAGAAGCTGG - Intergenic
1109591735 13:64492629-64492651 CTAATTTGGAGATGCAAAACTGG - Intergenic
1111502012 13:89133789-89133811 CTAGTAAGGAGATGTGAAACGGG + Intergenic
1112705715 13:102067452-102067474 CCAATTAGGAGTTGAGAAAATGG - Intronic
1112924650 13:104659329-104659351 CTAAGTGGGAGATGAGAAAGAGG + Intergenic
1114841128 14:26262869-26262891 ATAATTTTGAGATGAGAATCTGG - Intergenic
1116623809 14:47240786-47240808 CTAATTGGGAGATCAGGAGAGGG - Intronic
1116626834 14:47276150-47276172 TTAATTAAGAGATGAATAGCTGG - Intronic
1123954574 15:25322015-25322037 CTAATTAGTATGTTAGAAGCTGG + Intergenic
1129659408 15:77544625-77544647 CTAAGAAGGAGAGGAGAGGCAGG - Intergenic
1130118835 15:81029236-81029258 ATAATTAGAAGATGAGAATATGG - Intronic
1130193841 15:81760910-81760932 CTAGGGAGGAGATGAGATGCAGG - Intergenic
1130212484 15:81937831-81937853 CTAATGAAGAGATGAGAATTTGG - Intergenic
1132845085 16:1997206-1997228 CTGGCTAGGAGATGAGAGGCTGG - Intergenic
1134812199 16:17177228-17177250 CTAAGAAGGAGATGGGCAGCAGG - Intronic
1139699840 16:68701316-68701338 CTGTTTTGCAGATGAGAAGCAGG - Intronic
1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG + Intronic
1140257979 16:73352984-73353006 CTGATGAGGAGATGTGGAGCAGG + Intergenic
1141278923 16:82613196-82613218 GTTATTAGGCGATTAGAAGCTGG + Intergenic
1141317071 16:82972430-82972452 CTAAAGAAGAGATGAGATGCTGG - Intronic
1141894755 16:86952236-86952258 CGAATGAGGAAACGAGAAGCAGG + Intergenic
1148134356 17:45282789-45282811 CTGATTAGGAGATGGGGACCGGG - Intronic
1148443261 17:47722619-47722641 CCATTTTGCAGATGAGAAGCTGG - Intergenic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1150676207 17:67246862-67246884 CTTATTCCGAGGTGAGAAGCAGG - Intergenic
1151084996 17:71370060-71370082 GTATTTCTGAGATGAGAAGCTGG + Intergenic
1153968120 18:10200483-10200505 CTTCTAAGGAGATGGGAAGCAGG + Intergenic
1155085680 18:22455379-22455401 AAAAATAGGAGATGAGAAGTAGG + Intergenic
1156800200 18:41101720-41101742 CTAATTGAAAGATGAGAAACTGG + Intergenic
1156869153 18:41925020-41925042 CAAATGAGGATATGAAAAGCAGG + Intergenic
1156993283 18:43436045-43436067 CTAATTATGTGATTAGAAGTTGG - Intergenic
1157157941 18:45285938-45285960 CCAATTAGGTGAGAAGAAGCTGG - Intronic
1158945695 18:62445258-62445280 CTATTTAGGGGAGAAGAAGCTGG - Intergenic
1160629121 18:80233070-80233092 CTCCTCAGGAGATGAGCAGCTGG - Intronic
1160786239 19:901300-901322 TTCATTAGGAGATCAGAAGTGGG + Intronic
1164484569 19:28643745-28643767 ATATTTAGGACATAAGAAGCTGG - Intergenic
1164681852 19:30139864-30139886 ATAATTAGGCCATGAGACGCAGG + Intergenic
925288283 2:2730068-2730090 GGAATGAAGAGATGAGAAGCTGG - Intergenic
928610516 2:32987456-32987478 TTAGTGAGGAGATGAGAAGCAGG + Intronic
930399664 2:50867209-50867231 CTACATAGGAGATGGGAAGAGGG - Intronic
932719386 2:74127152-74127174 CAAATGAGGGGATCAGAAGCTGG + Intergenic
934116565 2:88802808-88802830 CTATTTAGAAAATGAGATGCAGG + Intergenic
935400235 2:102652563-102652585 TTAAAAAGGAGATGAGAAGTGGG - Intronic
936894584 2:117413076-117413098 AAAATTAGGAAATGAGAGGCAGG + Intergenic
939114718 2:138047298-138047320 CTAATTAGGAGTTGAGCAGTGGG - Intergenic
941457156 2:165722715-165722737 ATAATTAGGAGGTGAACAGCAGG + Intergenic
943247168 2:185470595-185470617 GTAATTTGGAGATGAGAAAAGGG - Intergenic
944709436 2:202322487-202322509 TAAATTAGGAGATGAGCAGCAGG - Intergenic
948081334 2:235207662-235207684 CTCAGTAGGAGTTGAGTAGCAGG + Intergenic
1173085618 20:39913526-39913548 AGAAGTAGGAGATGAGAATCAGG + Intergenic
1174026156 20:47577617-47577639 TTAATTAGGAAAAGGGAAGCAGG - Intronic
1175556859 20:59869156-59869178 CTAATAAAGAAATGAAAAGCAGG - Intronic
1175698291 20:61118878-61118900 CTTATTAGGTGATGAGAACTGGG - Intergenic
1176159928 20:63642731-63642753 CTAATTGGGAGCTGGGAACCCGG - Intronic
1177806452 21:25879664-25879686 CTAAGTAGGACATGGGAAACTGG - Intergenic
1177942355 21:27426272-27426294 CTAATAAGAAGATGGGGAGCTGG - Intergenic
1178481809 21:32985936-32985958 CTGATAAGGACATGAGACGCGGG + Intergenic
1181415593 22:22756487-22756509 CCAATAAGGAGCTGTGAAGCTGG - Intronic
1181958433 22:26605187-26605209 CTAACTAGGAAAGCAGAAGCAGG - Intronic
1182391714 22:30002857-30002879 CTAAAGAGAAGATGAGAAGTGGG - Intronic
1182550016 22:31095829-31095851 CTAGGAAGGAGAAGAGAAGCTGG - Intronic
1182716199 22:32357761-32357783 AGAATTAGGAGCTGAGAGGCTGG - Intronic
1183627895 22:39015777-39015799 CTAAATAGGAGCTAAGCAGCTGG + Intronic
1183630473 22:39029545-39029567 CTAAATAGGAGCTAAGCAGCTGG + Intronic
1184269080 22:43367955-43367977 TTAATGGGGAGATGAGAAACAGG - Intergenic
1184794708 22:46725232-46725254 CTAATTAGGAGATAAAGAACCGG + Intronic
949743975 3:7267438-7267460 CTAATCAGGAGTTGGGAAGCAGG + Intronic
950894184 3:16433221-16433243 CTAATTAAGAAAAGAGAAGTGGG - Intronic
952996284 3:38885704-38885726 CCAATTATGTGATGAGAAGAAGG + Intronic
953827026 3:46262257-46262279 CTATCCAGCAGATGAGAAGCTGG + Intronic
953935187 3:47035470-47035492 CAAAGTAGGAGCTGAGAAGTAGG - Intronic
955161239 3:56467601-56467623 ATAATTAGGAGATGGGGAGGAGG + Intronic
955563063 3:60213776-60213798 CTAATTAGGTGATCACAATCAGG - Intronic
955913481 3:63882233-63882255 CTAATTTCCAGATGAGAAACAGG - Intronic
959986105 3:112572905-112572927 CTAGTTAGGAGATGAGTAAGAGG - Intronic
960324249 3:116275778-116275800 CAAATTGGGAGAAGAGAAGTAGG - Intronic
962352737 3:134667533-134667555 CCAGTTAAGAGATGAGAAGGAGG - Intronic
963583577 3:147156250-147156272 CTAATAAAGAGATGAGGAGAGGG + Intergenic
965411104 3:168332711-168332733 CTATTTCAGAGATGAGAAGGTGG + Intergenic
965728238 3:171743275-171743297 CTAAATAAGAGATGAAAAGCAGG - Intronic
967681349 3:192367664-192367686 CTATTTAGTAAAGGAGAAGCAGG + Intronic
967703108 3:192617796-192617818 CTAAGTAGGAGAGGAAAAACTGG + Intronic
968440492 4:621560-621582 GTAATGAGGAGATGCGGAGCAGG - Intergenic
972330443 4:38059321-38059343 CTACTTAGTATTTGAGAAGCAGG - Intronic
973900436 4:55464610-55464632 GTAAAAAGGAGCTGAGAAGCAGG + Intronic
975354420 4:73384085-73384107 TAAATTAAGAGATGAAAAGCTGG - Intergenic
978245504 4:106567576-106567598 ATAATTATGATATGAGAAACAGG + Intergenic
978992310 4:115099543-115099565 CCATTTAGGATATGAGAAGATGG + Intronic
983991439 4:174124827-174124849 CTAAAAAGGAGCTGAGAAGAAGG - Intergenic
984942627 4:184947208-184947230 CTAATTAGGAAATTAGAAAAAGG - Intergenic
986473756 5:8102982-8103004 CTAAATAAGAGATGAGAAAGTGG - Intergenic
987840540 5:23217883-23217905 TCAATTAGGAGATGAGAGGTAGG + Intergenic
987970710 5:24940374-24940396 CAAATTAGAAGCTGATAAGCTGG + Intergenic
989180271 5:38569368-38569390 CTCAGCAGGAGGTGAGAAGCAGG + Intronic
989180275 5:38569397-38569419 CTCAGCAGGAGGTGAGAAGCAGG + Intronic
990753706 5:59044398-59044420 AGAATTAAGAGAAGAGAAGCTGG - Intronic
990876261 5:60489808-60489830 TTATTAAGGAGATGAGAAGCAGG - Intronic
990977968 5:61575512-61575534 AGAATTAAGAGATGAGAAGATGG + Intergenic
991304141 5:65158861-65158883 ATAATAAGGAAATCAGAAGCAGG - Intronic
991934518 5:71788894-71788916 ATAATTAGTATATGAGAAGATGG + Intergenic
993044613 5:82853284-82853306 CGAATTAGAATTTGAGAAGCTGG + Intergenic
993488282 5:88514127-88514149 GCCATTAGGAGATGGGAAGCAGG + Intergenic
993820533 5:92609543-92609565 CCAATTAGGATCTCAGAAGCTGG - Intergenic
994297902 5:98113131-98113153 CACACTAGGAGATGAGCAGCTGG + Intergenic
1007611168 6:43150126-43150148 CTAATGATGTGATGAGAAGCAGG + Intronic
1011165720 6:84443693-84443715 TTAAGCAGGAGGTGAGAAGCAGG - Intergenic
1014139825 6:117928536-117928558 ATAATTCTGAGATGAGAACCAGG + Intronic
1018568338 6:165181813-165181835 ATAATTAGGAGAAGATAAGATGG - Intergenic
1020547991 7:9558025-9558047 CTCATTAAGAAATGAGATGCTGG + Intergenic
1020986100 7:15136367-15136389 GTAATTAGGAGATAAAAAGCAGG - Intergenic
1022073777 7:26945253-26945275 CTAACTAGGAAATGACTAGCAGG + Intronic
1023295533 7:38711498-38711520 CTGATTAGGAGGCGAGAAACAGG + Intergenic
1025074310 7:55929407-55929429 CAAATTAGGAGGTGAAAAGTGGG + Intronic
1025238310 7:57250185-57250207 CTAATAACGACATGAGAAGGTGG + Intergenic
1028250366 7:88533028-88533050 CAAAGTAGGAGAGGAGAAGATGG - Intergenic
1029095827 7:98084465-98084487 CTAAGTAGGAAATGAGGAACAGG + Intergenic
1029812298 7:103061542-103061564 CCATTTAGGAGAGGAGGAGCTGG - Intronic
1030332301 7:108284116-108284138 ATAATTTGGAAATGAGAGGCTGG - Intronic
1036131200 8:6115461-6115483 CTAATTTCCAAATGAGAAGCCGG + Intergenic
1036196592 8:6722151-6722173 CTTATTAGGAGACCAGAAACTGG - Intronic
1037072522 8:14669245-14669267 CTACTCAGGAGGTGAGAGGCAGG + Intronic
1038393400 8:27227027-27227049 CTAATTTGGAGAAAAGAAGATGG - Intergenic
1042461267 8:69072003-69072025 CCAATCAGGAGATCATAAGCTGG + Intergenic
1044351707 8:91174128-91174150 CTATTTATAAGATGAGAAACAGG + Intronic
1045685080 8:104703333-104703355 CTAATTAAGAAAAGAGAGGCAGG + Intronic
1050632381 9:7573861-7573883 CTTATCAGGAGCTGAGAACCTGG + Intergenic
1052154760 9:25171765-25171787 CTTATTAGGAGATAAAAATCTGG - Intergenic
1052804125 9:32997563-32997585 CTAATTAGGTGAGGAGCAGGAGG + Intronic
1055093799 9:72389699-72389721 GTAATGAGCAGATGAGAAGAGGG + Intergenic
1058871750 9:109207796-109207818 CCAGTCAGGAGATGAGAACCGGG - Intronic
1059597710 9:115740787-115740809 CTAAATAGCAGTTGCGAAGCAGG + Intergenic
1060064420 9:120490748-120490770 CTAACTAGGAGAATAGAAGCAGG - Intronic
1060840882 9:126792262-126792284 CTAATTGGGAGACTTGAAGCAGG + Intergenic
1203583443 Un_KI270746v1:37884-37906 CTATTTAGAAAATGAGATGCAGG + Intergenic
1185698041 X:2210619-2210641 CTAATGAGGAGATGAGGAGTTGG + Intergenic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic
1188656224 X:32699429-32699451 CTAATTAGAACATGAGAATGAGG + Intronic
1188709105 X:33372269-33372291 CTAATTAGGAGATAATAATTAGG + Intergenic
1189609398 X:42715619-42715641 CGAGTTAGGAGATGAGAAGCAGG - Intergenic
1190703138 X:53003072-53003094 CTAATAAGAGGAGGAGAAGCTGG - Intergenic
1199372526 X:147067887-147067909 TTAATTAGTAGATGAGAAAATGG + Intergenic