ID: 1139962282

View in Genome Browser
Species Human (GRCh38)
Location 16:70724908-70724930
Sequence CACCTACCCAGAATGCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139962282_1139962290 13 Left 1139962282 16:70724908-70724930 CCCATCTGCATTCTGGGTAGGTG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 84
1139962282_1139962289 9 Left 1139962282 16:70724908-70724930 CCCATCTGCATTCTGGGTAGGTG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1139962289 16:70724940-70724962 CTCTTCTAGCAAACAGACTTAGG 0: 1
1: 0
2: 1
3: 25
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139962282 Original CRISPR CACCTACCCAGAATGCAGAT GGG (reversed) Intronic
900581880 1:3413481-3413503 CCCCTCCCTAGAATGCAGGTGGG + Intronic
902570389 1:17343305-17343327 GGCCTCCCCAAAATGCAGATGGG - Intronic
902806423 1:18863920-18863942 AACCCACCCAGTATACAGATAGG + Intronic
903422866 1:23231297-23231319 CCCCTACCACGAAAGCAGATGGG - Intergenic
907004577 1:50898190-50898212 CAGCTACCCAGGAGGCTGATGGG + Intronic
907291066 1:53413213-53413235 CAACTACCCGGAATGCAGGCGGG - Intergenic
911770570 1:101735687-101735709 CACTTACCTAGAATGCAGCCAGG - Intergenic
916204621 1:162303553-162303575 CAGCTACCCAGAAGGCTGAGGGG - Intronic
916721719 1:167489384-167489406 CACCTACCCACAAAGCAGGCAGG - Intronic
918014902 1:180623750-180623772 CATCTAGGAAGAATGCAGATAGG + Intergenic
918278957 1:182984172-182984194 CACCGACACAGAATGAAGAATGG + Intergenic
919762341 1:201106078-201106100 CACTTACCAAGACTGCAGATGGG - Intronic
920178866 1:204120344-204120366 TACCTGCCCAGAAAGCAGTTGGG - Intronic
923410637 1:233705451-233705473 GACCTTCCCAGAAGGCAGTTAGG - Intergenic
924315846 1:242795516-242795538 GACTTACCCAGAATGCAGCAGGG - Intergenic
1062936707 10:1395703-1395725 CAGCTGCCCAGGACGCAGATAGG - Intronic
1063179869 10:3588441-3588463 CAGCTACCGAGAATACAGAGTGG + Intergenic
1063785715 10:9380582-9380604 CACCTACCCACATTGTGGATAGG - Intergenic
1064162900 10:12960934-12960956 TACCAACCCAGACTGCAGAGAGG - Intronic
1064349118 10:14560180-14560202 AAGCCACCCAGAATGCAGATGGG - Intronic
1069931272 10:71883324-71883346 CACCTGCGCAGAATGCAATTTGG + Intergenic
1071271399 10:84010893-84010915 CAACCCCCCAGAATCCAGATTGG + Intergenic
1071846561 10:89526880-89526902 CACCTACTCAGATAGCAGAAGGG + Intronic
1072154293 10:92709872-92709894 AACCCATCCAGAAAGCAGATTGG - Intergenic
1072252320 10:93591311-93591333 CCCCTACCCGGAATGCAGGGAGG - Intronic
1073463757 10:103681773-103681795 CACACACACAAAATGCAGATCGG + Intronic
1077601300 11:3576703-3576725 CACCCACCTAGACTGCAGAGTGG - Intergenic
1080340272 11:31254974-31254996 CACAGAGACAGAATGCAGATTGG - Intronic
1080408295 11:31999734-31999756 CTCCTACCTATAATGGAGATGGG + Intronic
1080442857 11:32311397-32311419 CACCTACCCAAAAAGCAAATTGG + Intergenic
1083537914 11:63488925-63488947 CACCCAGCCAGAAAGCAGACTGG - Exonic
1084257216 11:67951277-67951299 CACCCACCTAGACTGCAGAGTGG - Intergenic
1084815562 11:71643991-71644013 CACCCACCTAGACTGCAGAGTGG + Intergenic
1086063274 11:82721674-82721696 CATCTTCCCACAATGCACATGGG + Intergenic
1091340311 11:134806929-134806951 CACCTTCCCAGAGAGCAGCTGGG - Intergenic
1092427449 12:8386063-8386085 CACCCACCTAGACTGCAGAGTGG - Intergenic
1094654681 12:32408934-32408956 AACCTTCCCAGAGGGCAGATGGG - Intronic
1095700487 12:45186070-45186092 GACCTACCCAGACAGCACATTGG - Intergenic
1095923244 12:47552413-47552435 CAACTGCCCAGAATGCAGTGTGG + Intergenic
1101271883 12:103156105-103156127 GACCTGCCCAGAAGGCAGAAGGG - Exonic
1103871309 12:124094360-124094382 CAGCAACCCAGAATGCACAAAGG - Intronic
1103904633 12:124321075-124321097 CCCCTACCCAGAATCCAGGATGG - Intergenic
1108020621 13:46124570-46124592 CACCCACCCACACAGCAGATGGG - Intergenic
1110557453 13:76876619-76876641 CACCCACCCAAAAAGCAGAATGG + Intergenic
1114745718 14:25144604-25144626 CACCTATTAAGAATGCAGATTGG + Intergenic
1115945871 14:38659724-38659746 CTCCTACCCAGAAGGTAGGTAGG - Intergenic
1118560158 14:67070730-67070752 CACATATACAGAATGCTGATTGG - Intronic
1118684116 14:68273798-68273820 CAACTACTCAGGATGCTGATGGG - Intronic
1126081613 15:44968715-44968737 CAGCCACCCAGAATGCTGCTAGG + Intronic
1126660040 15:51023973-51023995 CACCTACCATGACTGCAGAAGGG - Intergenic
1127934754 15:63626152-63626174 CACCTGTCCAGAAAGCAAATGGG + Exonic
1128343719 15:66840919-66840941 CCTCTGCCCAGAATGTAGATGGG + Intergenic
1130312592 15:82768217-82768239 CACCTAGCTAGAATTCAGAGAGG - Intronic
1130563584 15:84977248-84977270 CACCTACCCAAAATACAGGAAGG - Intergenic
1132762838 16:1519355-1519377 CACCTGCCCATAATAAAGATGGG + Intronic
1133370798 16:5244315-5244337 CACCCACCTAGACTGCAGAGTGG + Intergenic
1135002047 16:18784925-18784947 AACCAACCCAGCATTCAGATGGG + Intronic
1138979364 16:62248416-62248438 TATCTACCCAGAAAGTAGATCGG - Intergenic
1139962282 16:70724908-70724930 CACCTACCCAGAATGCAGATGGG - Intronic
1141341523 16:83208310-83208332 CAGCTACCCAGACTGCTGAATGG + Intronic
1141364463 16:83429619-83429641 AACCTACTCAGAATGCTGAGGGG + Intronic
1144351923 17:14404949-14404971 CACCTCCCCAGAAAGCACAGTGG + Intergenic
1144850181 17:18240290-18240312 CATCTGCACAGAATGCTGATGGG - Intronic
1152196918 17:78923874-78923896 CACCTGCCCAGAGTGGAGGTGGG - Intronic
1152519642 17:80847714-80847736 CGCCTTCCTAGAAAGCAGATCGG + Intronic
1152835281 17:82526211-82526233 GTCCTACTCAGAATGCAGATGGG + Intronic
1156508751 18:37617060-37617082 CTCCTACTCAGAATGCTAATCGG - Intergenic
1156749785 18:40438033-40438055 CAACTAGCCAGGATGCAGAGGGG - Intergenic
1157172862 18:45424127-45424149 CATCTTCCCAGAATTCAGCTAGG - Intronic
1161155802 19:2731478-2731500 CACCTACCCACAAGGCTGACTGG - Intronic
1161496048 19:4586409-4586431 CACCTCCCCAGTATGCAGCAGGG + Intergenic
1162753957 19:12846086-12846108 CAGCTACACAGAAGGCAGAGGGG + Intronic
928219820 2:29394505-29394527 CCCCTGCCCAGAATTCAGCTGGG - Intronic
928417802 2:31111150-31111172 AGACTACCCAGGATGCAGATGGG + Intronic
931164250 2:59729106-59729128 CACATAAGCAGAATGCAAATTGG + Intergenic
931511211 2:62997336-62997358 CTCCTAACCAGAGGGCAGATTGG + Intronic
931964069 2:67514172-67514194 AACTTACCCAGAATGGAGAATGG + Intergenic
936418243 2:112339456-112339478 CATCCACCCAGAATTCAGAAAGG + Exonic
941383313 2:164822451-164822473 CAACAACCCAGAAGGCATATGGG - Intronic
941936930 2:170989452-170989474 CAACTACCCATCATGCAGAGTGG - Intergenic
943135084 2:183899968-183899990 CACCTACTCAGAATGTAAACTGG + Intergenic
945232068 2:207602329-207602351 CACCGTACCAGAATGCAGACAGG - Exonic
945614553 2:212052083-212052105 TGCCTACCCAGATTGCAGGTGGG - Intronic
947379522 2:229531955-229531977 CACAGAGACAGAATGCAGATTGG + Intronic
948048831 2:234964396-234964418 CCCCCACCCGGAATGCAGAGGGG - Intronic
1169912624 20:10659664-10659686 CCTCTGCCCAGAAGGCAGATGGG + Intronic
1177424506 21:20904997-20905019 TACCCACCCAGAATGAAGGTGGG - Intergenic
1177489588 21:21805140-21805162 CACCCACCCAGATTGACGATGGG - Intergenic
1179278398 21:39912559-39912581 CACCTAGGCAGAATTCAGATGGG - Intronic
1179956908 21:44745952-44745974 CATCTTCCCAGTATGCAGGTGGG - Intergenic
950750341 3:15123443-15123465 CACCCACCTAGACTGCAGAGTGG + Intergenic
952710917 3:36431344-36431366 CAGCAACTCAGAATGCAGAGTGG + Intronic
956468090 3:69538456-69538478 CTGCAACCCAGAATGCACATAGG + Intronic
959446402 3:106445437-106445459 CACCTACCTAAAAAGCAGCTGGG - Intergenic
961281984 3:125771328-125771350 CACCCACCTAGACTGCAGAATGG + Intergenic
963548861 3:146696103-146696125 CATCTACCCACAGTGCATATAGG + Intergenic
964624466 3:158746139-158746161 CAGCTACTCAGAAGGCTGATGGG - Intronic
966143852 3:176787691-176787713 CACCCTCCCAGTGTGCAGATGGG + Intergenic
969015744 4:4103078-4103100 CACCCACCTAGACTGCAGAGTGG - Intergenic
969738215 4:9005283-9005305 CACCCACCTAGACTGCAGAGTGG + Intergenic
969946803 4:10791480-10791502 CACCCCCTCAGAATGCAGAGAGG - Intergenic
971223991 4:24734580-24734602 CACCTACCCATAATACCAATGGG - Intergenic
971354876 4:25886450-25886472 CACCTGCTCAGAATGGAGGTAGG - Intronic
972312770 4:37896225-37896247 CACCTCCTCAGAATGCTGGTGGG - Intronic
972481427 4:39500766-39500788 CAGCTACTCAGAAGGCAGACAGG - Intronic
972940817 4:44192766-44192788 CACCCACCCACAATCCAGGTGGG + Intronic
977400047 4:96521168-96521190 CACCCACCCAGAATGCAGGCTGG - Intergenic
979572675 4:122248075-122248097 CACAGACCCAGAATGCAGACAGG - Intronic
979909792 4:126348674-126348696 CAACTACTCAAAATGCATATTGG - Intergenic
981107984 4:140903117-140903139 CACCTAACAAAAATGCAGAAAGG + Intronic
986025415 5:3845966-3845988 CACCTCCCCAGAGAGGAGATAGG - Intergenic
987648196 5:20703892-20703914 CACCCACCCTCAATGCAGGTGGG - Intergenic
996512060 5:124327978-124328000 CACCTCCCCAGAATGCTTACTGG + Intergenic
997286461 5:132682242-132682264 CACCCACCCCAAAAGCAGATAGG + Intronic
1002083116 5:176749129-176749151 CTCCTATCCAGAACGCTGATGGG - Intergenic
1003183224 6:3809599-3809621 CAGCTACTCAGAAGGCAGAGGGG - Intergenic
1006009674 6:31032008-31032030 CATGTCCCCAGAATGCAGGTGGG - Intronic
1007594201 6:43041492-43041514 CAGCTACCCAGAAGGCTGAGAGG + Intronic
1009537823 6:64912357-64912379 CCCCTACCCACAATGTACATAGG + Intronic
1011433617 6:87314627-87314649 CACTTGCCCAGAATGAAGGTGGG - Intronic
1013134900 6:107272651-107272673 AACCTTTCCAGAAAGCAGATTGG + Intronic
1018153032 6:160957873-160957895 CACCTACCCAAAATGAAGGAGGG + Intergenic
1019336185 7:484053-484075 CCCCTCCCCAGACTGCAGAGAGG + Intergenic
1027372822 7:77524573-77524595 CATATAGACAGAATGCAGATTGG + Intergenic
1029074415 7:97924712-97924734 CACCCACCTAGACTGCAGAGTGG - Intergenic
1031980347 7:128120659-128120681 CACCTACCCAGACTCCAGCAAGG + Intergenic
1033621845 7:143069055-143069077 CACCCACCGGGAATGCAGAGGGG + Intergenic
1036243292 8:7096578-7096600 CACCCACCTAGACTGCAGAGTGG + Intergenic
1036391919 8:8330991-8331013 CTGCTGCCCAGAATGCAGAAAGG - Intronic
1036654795 8:10671273-10671295 GACCTCCCCAGGATGCAGCTGGG - Intronic
1036898539 8:12654852-12654874 CACCCACCTAGACTGCAGAGTGG - Intergenic
1038949094 8:32394250-32394272 CAGCTACTCAGCATGGAGATGGG - Intronic
1043509159 8:80932586-80932608 TGCCTACCCAGATTGCAGGTGGG - Intergenic
1044241048 8:89888948-89888970 CAGCTACTCAGAAGGCAGAGAGG + Intergenic
1045249588 8:100472402-100472424 CACCTAGCCAGCAGGCTGATGGG - Intergenic
1050084333 9:1949030-1949052 GTCCCACCCAGAATGCTGATGGG - Intergenic
1050274497 9:3982828-3982850 CAGCTACCCAGAAAGAAGGTAGG + Intronic
1052176104 9:25464546-25464568 GACCTCCCCAGAATGCAGAATGG - Intergenic
1058423177 9:104852947-104852969 CAAGGACCCAGAATACAGATGGG - Intronic
1058868427 9:109182362-109182384 CACAGACACAGAATGCAGACTGG + Intronic
1192539894 X:71958893-71958915 CAACTGCCAAGGATGCAGATAGG + Intergenic
1192882708 X:75304097-75304119 CACCTACCAACAATGCAGTTTGG - Exonic
1199717847 X:150518878-150518900 CATCTTCCCAGAATACAGAAAGG - Intergenic
1200042224 X:153378901-153378923 CAGCTACCCCAAATGCAGATGGG + Intergenic
1201219470 Y:11754123-11754145 GACTTACCCAGAATGCAGCAGGG - Intergenic