ID: 1139962283

View in Genome Browser
Species Human (GRCh38)
Location 16:70724909-70724931
Sequence CCACCTACCCAGAATGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139962283_1139962289 8 Left 1139962283 16:70724909-70724931 CCATCTGCATTCTGGGTAGGTGG 0: 1
1: 0
2: 1
3: 23
4: 344
Right 1139962289 16:70724940-70724962 CTCTTCTAGCAAACAGACTTAGG 0: 1
1: 0
2: 1
3: 25
4: 206
1139962283_1139962290 12 Left 1139962283 16:70724909-70724931 CCATCTGCATTCTGGGTAGGTGG 0: 1
1: 0
2: 1
3: 23
4: 344
Right 1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139962283 Original CRISPR CCACCTACCCAGAATGCAGA TGG (reversed) Intronic
901135148 1:6988182-6988204 CCACCTCCCCAGACTGCACTGGG - Intronic
901563266 1:10090232-10090254 CCACCTACTCAGGAAGCTGAGGG - Intronic
901857258 1:12052498-12052520 CCACCTACCCAGACTGTGGTGGG - Intergenic
902126233 1:14213963-14213985 CCACTTACCAAGAGTGAAGATGG + Intergenic
902781220 1:18706133-18706155 CCACCTGCCCAGAGTGAGGAGGG - Intronic
903422868 1:23231298-23231320 CCCCCTACCACGAAAGCAGATGG - Intergenic
904383343 1:30125849-30125871 CCCCCTTGGCAGAATGCAGATGG - Intergenic
904788384 1:32999231-32999253 CCACCTTCCCAAATTGCTGAAGG - Intergenic
907004576 1:50898189-50898211 CCAGCTACCCAGGAGGCTGATGG + Intronic
907240731 1:53079539-53079561 CCACCTCACCAGTCTGCAGAGGG + Intronic
907291067 1:53413214-53413236 CCAACTACCCGGAATGCAGGCGG - Intergenic
907423554 1:54363908-54363930 CCACCTCCCCAGCAACCAGAGGG + Intronic
907689172 1:56645308-56645330 CCGCCTACCCACAGTGCAGCGGG - Exonic
908526727 1:64994979-64995001 AAACCTACCCAGAATCCAGCAGG + Intergenic
909572273 1:77128559-77128581 CCAGCTAACCTGAATGCACAAGG + Intronic
910986982 1:93014769-93014791 CCACCAAGCCAGAAGGAAGAAGG + Intergenic
911388512 1:97208397-97208419 CCAGCTACCCAGGAGGCTGAAGG - Intronic
911606713 1:99914227-99914249 CCAGCTACCCTGAAAGCTGAGGG + Intronic
911750819 1:101495801-101495823 CCAGCTACTCAGAAGGCTGATGG - Intergenic
912389370 1:109291658-109291680 CCAGCTACTCAGGATGCTGAGGG - Intergenic
912573379 1:110641523-110641545 GCACCTACTCACAATGCACAAGG - Intergenic
913566811 1:120080670-120080692 CCACTTACCCAGGAGGCTGAGGG - Intergenic
913631318 1:120712879-120712901 CCACTTACCCAGGAGGCTGAGGG + Intergenic
914287568 1:146241377-146241399 CCACTTACCCAGGAGGCTGAGGG - Intergenic
914399196 1:147300310-147300332 CCAGCTACTCAGAAGGCTGAGGG + Intergenic
914548599 1:148692120-148692142 CCACTTACCCAGGAGGCTGAGGG - Intergenic
914618081 1:149379591-149379613 CCACTTACCCAGGAGGCTGAGGG + Intergenic
915140554 1:153765298-153765320 CCAGCTACTCAGGATGCTGAGGG - Intronic
915289305 1:154872193-154872215 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
916204622 1:162303554-162303576 CCAGCTACCCAGAAGGCTGAGGG - Intronic
918780740 1:188697070-188697092 CCACCTACTCAGGAGGCTGAGGG + Intergenic
919762342 1:201106079-201106101 TCACTTACCAAGACTGCAGATGG - Intronic
922656405 1:227387975-227387997 CCAGCTACTCAGAAGGCTGAGGG + Intergenic
923026505 1:230208828-230208850 CCACCCACCCAGAGCGAAGATGG + Intronic
923713903 1:236408866-236408888 CCAGCTACCCAGGAGGCTGAGGG - Intronic
924315847 1:242795517-242795539 GGACTTACCCAGAATGCAGCAGG - Intergenic
1063675550 10:8138309-8138331 CCACCTACTCAGGAGGCTGAGGG - Intergenic
1063890897 10:10627460-10627482 TCACCTCTCTAGAATGCAGAGGG + Intergenic
1064349119 10:14560181-14560203 TAAGCCACCCAGAATGCAGATGG - Intronic
1064857780 10:19790512-19790534 CCACCTTTCCAAAATTCAGATGG + Intergenic
1065513708 10:26504867-26504889 CCAGCTACTCAGAAGGCTGAGGG - Intronic
1067278601 10:44854938-44854960 CCACCTGCCCAGAATGAGGAGGG + Intergenic
1068648994 10:59500780-59500802 CCAGCTTCCCTGTATGCAGAAGG + Intergenic
1069464449 10:68625967-68625989 CCATCTACTCAGAAGGCTGAGGG + Intronic
1069717465 10:70530159-70530181 CCACCTCTCCAGCATGCAGCAGG - Intronic
1071466253 10:85942362-85942384 CCACCTTCACAGAGTTCAGAGGG + Intronic
1071846560 10:89526879-89526901 ACACCTACTCAGATAGCAGAAGG + Intronic
1073292305 10:102419321-102419343 CCACCCTCCCAGGATGCAGCAGG + Intronic
1074598313 10:114887944-114887966 GCACCTAACCAGAAGTCAGAGGG - Intronic
1074952761 10:118355733-118355755 CCACCTCCCCTGAACCCAGAAGG - Intergenic
1076484101 10:130804824-130804846 CCACCTACCCAGAGGGGAGGAGG - Intergenic
1077167333 11:1149728-1149750 CCACACACACAGAAAGCAGATGG - Intergenic
1077546225 11:3171223-3171245 ACACGCACCCAGGATGCAGAGGG - Intergenic
1078650480 11:13186236-13186258 AAACCTAACCAGAAGGCAGAGGG + Intergenic
1078923440 11:15852577-15852599 CCAATTCCCCAGAATGCCGAGGG - Intergenic
1079197789 11:18345611-18345633 CCACCTACTCAGGAAGCTGAGGG - Intronic
1079218051 11:18532756-18532778 CCTCCTACCCATATTGCAGGGGG - Intronic
1080408294 11:31999733-31999755 CCTCCTACCTATAATGGAGATGG + Intronic
1081866944 11:46365434-46365456 GCACACACCCAGAATCCAGAAGG + Intronic
1081893922 11:46568341-46568363 CCAGCTACTCAGAAGGCTGAGGG + Intronic
1083097082 11:60262073-60262095 TCCCCTACCTAGAATGCATATGG - Intergenic
1083105394 11:60353296-60353318 CCCTCTACCGAGAATGCATATGG + Intronic
1083308346 11:61772241-61772263 CTACCTTCCTGGAATGCAGAGGG - Intronic
1083581131 11:63826360-63826382 CCACCTTACCAGTATGGAGAAGG - Intronic
1083709435 11:64539089-64539111 CCACCCACCCACCAAGCAGAAGG - Intergenic
1084889101 11:72228048-72228070 CCACCTGCCCAGGCTGCACAGGG - Intronic
1085186264 11:74578612-74578634 CCAGCTACTCAGAAGGCTGAGGG + Intronic
1086382748 11:86274707-86274729 CCAACTACCCAGAGTGTAAATGG - Intronic
1087429898 11:98040339-98040361 CCTCCTACCCAAAATACAAATGG + Intergenic
1091340312 11:134806930-134806952 CCACCTTCCCAGAGAGCAGCTGG - Intergenic
1091477363 12:788770-788792 CCAGCTACCCAGGAGGCTGAGGG + Intronic
1091735209 12:2915657-2915679 CCAGCTACTCAGAAGGCTGAGGG - Intronic
1092255302 12:6923844-6923866 CCACCTAGCCAGAATGGGGTAGG - Intergenic
1093624623 12:21330394-21330416 CCAGCTACTCAGAAGGCTGAGGG + Intronic
1094471884 12:30810104-30810126 CCAGCTACTCAGAAGGCTGAGGG - Intergenic
1094609492 12:31979656-31979678 CCACCTACTCAGAAAACAGAAGG - Intronic
1095525108 12:43116519-43116541 CCAGCTACTCAGAAGGCTGAGGG - Intergenic
1095983076 12:47983675-47983697 CCACCTACCTGGAACCCAGATGG + Exonic
1096339322 12:50784046-50784068 CCAACTACTCAGGAGGCAGAAGG + Intronic
1096411190 12:51378267-51378289 CCAGCTACTCAGAAGGCTGAAGG - Intronic
1096911821 12:54991518-54991540 CCACCCACCCAAACTGCAAAAGG + Intergenic
1096958639 12:55554129-55554151 CCAGCTACCCAGCATGCAGCTGG - Intergenic
1097218995 12:57435774-57435796 CCAGCTACTCAGAAGGCAGGAGG + Intronic
1097860319 12:64512366-64512388 CTAACTACCCAGGAGGCAGAAGG + Intergenic
1098633551 12:72754093-72754115 CCAGCTACTCAGAAGGCCGAGGG - Intergenic
1099215100 12:79843817-79843839 CCAGCTACTCAGAAGGCTGAGGG - Intronic
1099476357 12:83111989-83112011 CCAGCTACTCAGGATGCTGAGGG + Intronic
1099484222 12:83208366-83208388 CCAGCTACTCAGAAGGCTGAGGG + Intergenic
1100981684 12:100167138-100167160 ACACCTGCCCAAAATACAGAGGG + Intergenic
1101271884 12:103156106-103156128 TGACCTGCCCAGAAGGCAGAAGG - Exonic
1101398564 12:104369016-104369038 CACCCTGCCCAGCATGCAGAAGG + Intergenic
1101693315 12:107101365-107101387 ACACCTTCCCAGAATGCAGGTGG - Intergenic
1102331584 12:112036731-112036753 CCACCTACTCAGGAGGCCGAGGG + Intronic
1102404553 12:112661884-112661906 CCACCAACCCAAAATGCACTGGG - Intronic
1104426282 12:128681093-128681115 CCAGCTACTCAGGAGGCAGAGGG - Intronic
1104455264 12:128905945-128905967 CCAGCTACCCAGGAGGCTGAGGG - Intronic
1104932878 12:132348989-132349011 CCACCTTCCTGGAATGCAGCGGG + Intergenic
1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG + Intergenic
1105304775 13:19160753-19160775 CCACTCACTCAGAAGGCAGAAGG + Intergenic
1105682843 13:22746858-22746880 CCAGCTACTCAGAAGGCTGAGGG - Intergenic
1106161399 13:27204239-27204261 GAATCTAACCAGAATGCAGAGGG - Intergenic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1106668099 13:31873705-31873727 CATCCTACCTGGAATGCAGACGG - Intergenic
1107132429 13:36910912-36910934 CTACCTACCTAGCATGCAGGAGG + Intronic
1107235674 13:38166835-38166857 CTTCCTTCCCAGAATGCACATGG + Intergenic
1108020622 13:46124571-46124593 CCACCCACCCACACAGCAGATGG - Intergenic
1111327620 13:86719822-86719844 CCAGCTACTCAGGAGGCAGAGGG + Intergenic
1112883184 13:104134564-104134586 CCACCTACTCAGAAGGCTGAGGG - Intergenic
1113290888 13:108905117-108905139 CCAGCTACCCTGTATGAAGATGG - Intronic
1114204342 14:20554624-20554646 CCAGCTTCCCAGCTTGCAGATGG - Intergenic
1115964910 14:38877203-38877225 CCAGCTACTCAGAAGGCAGAAGG + Intergenic
1116963398 14:50990130-50990152 CCAGCTACTCAGGATGCTGAGGG - Intronic
1117951886 14:61091033-61091055 TCACAGACCCAGAATGCAGAAGG + Intergenic
1118684117 14:68273799-68273821 CCAACTACTCAGGATGCTGATGG - Intronic
1119246157 14:73110263-73110285 CCACTTGCCCAGGAGGCAGAGGG - Intronic
1121290679 14:92772382-92772404 CCAGCTACTCAGGAGGCAGAAGG + Intergenic
1121518886 14:94572103-94572125 CCAACTTCCCAGAAGGCACAGGG - Intronic
1121810659 14:96885901-96885923 CCATCTTCCCAGTTTGCAGACGG - Intronic
1122155316 14:99747071-99747093 CCAGCTACTCAGAAGGCTGAGGG + Intronic
1122799853 14:104224041-104224063 CCACCTACCCGGTGTGCTGAGGG + Intergenic
1125349004 15:38748047-38748069 CATCCTTCCCAGATTGCAGAGGG + Intergenic
1125387457 15:39153573-39153595 CCACCTACCAAAAAGGCTGATGG - Intergenic
1125456892 15:39869097-39869119 CCACTTGAACAGAATGCAGAGGG - Intronic
1126660041 15:51023974-51023996 ACACCTACCATGACTGCAGAAGG - Intergenic
1126806506 15:52354737-52354759 CCATCTACTCAGGAGGCAGAGGG + Intronic
1127309123 15:57736833-57736855 CCATCGGGCCAGAATGCAGAAGG - Intronic
1127729864 15:61789824-61789846 CCACCTAGGCAGAAGCCAGAGGG - Intergenic
1129964563 15:79722526-79722548 CCAGCTTCTCAGAAAGCAGAGGG - Intergenic
1131247993 15:90812520-90812542 CCTACTAGCCAGAAGGCAGAGGG - Intronic
1131337896 15:91567523-91567545 CCTCATAGCCAGAAAGCAGAAGG - Intergenic
1132950749 16:2560905-2560927 CCACCTGCCCGGGATGCAGCAGG - Intronic
1132963601 16:2639265-2639287 CCACCTGCCCGGGATGCAGCAGG + Intergenic
1133456237 16:5944842-5944864 CCAGCTACTCAGGAGGCAGAAGG + Intergenic
1133887451 16:9843836-9843858 CCAATTACCCAGAATGGAGGGGG + Intronic
1134381895 16:13735136-13735158 CCAGCTACTCAGAAGGCTGAAGG + Intergenic
1134673935 16:16076116-16076138 CCCCAGACCCAGAAAGCAGAAGG - Intronic
1135002046 16:18784924-18784946 CAACCAACCCAGCATTCAGATGG + Intronic
1135037860 16:19093274-19093296 CCAGCTACTCAGAAGGCTGAGGG - Intergenic
1135081152 16:19437058-19437080 CCAGCTACTCAGAATGCTGAGGG + Intronic
1135403006 16:22179100-22179122 ACACCTACTCAGAAGGCAGGAGG - Intronic
1136370757 16:29834551-29834573 CCAGCTACTCAGAAGGCTGAAGG + Intronic
1136523459 16:30812766-30812788 CCAGCTACTCAGGATGCTGAGGG - Intergenic
1137265200 16:46863118-46863140 CCACCTACTCAGTAAGCCGAGGG - Intergenic
1137495319 16:48965011-48965033 TCACCTTCCCAGAAGGCACATGG - Intergenic
1139273811 16:65708095-65708117 CCAGCTACTCAGAAGGCTGAAGG - Intergenic
1139962283 16:70724909-70724931 CCACCTACCCAGAATGCAGATGG - Intronic
1141345126 16:83237955-83237977 TCACATAGCCAGAAGGCAGAGGG + Intronic
1141364462 16:83429618-83429640 CAACCTACTCAGAATGCTGAGGG + Intronic
1141749295 16:85947546-85947568 CCACCTCACCAGGTTGCAGAGGG - Intergenic
1141896111 16:86959609-86959631 CCACCTACCCAGAATGGGCTGGG - Intergenic
1142576286 17:910295-910317 CCAGCTACTCAGAAGGCTGAGGG + Intronic
1145743563 17:27295950-27295972 CCACCTACTCAGGAGGCTGAGGG - Intronic
1146144623 17:30402449-30402471 CCAGCTACTCAGAAGGCTGAGGG + Intronic
1146496623 17:33328393-33328415 AAAGCTACCCAGAATTCAGAGGG + Intronic
1146836721 17:36117051-36117073 CCAGCCTTCCAGAATGCAGAGGG - Intergenic
1149475160 17:56954720-56954742 CCAGCTACTCAGGAGGCAGAGGG + Intronic
1149562524 17:57619029-57619051 CCTTCTTCCCAGCATGCAGAGGG - Intronic
1149662185 17:58339772-58339794 CCCTCTACCCGGAAGGCAGAGGG + Intergenic
1149695806 17:58615276-58615298 CCACCCACCCACACTGCAGCAGG - Exonic
1151991015 17:77574325-77574347 CCACCTACCCAAAGAGCACAAGG - Intergenic
1152835280 17:82526210-82526232 TGTCCTACTCAGAATGCAGATGG + Intronic
1153300337 18:3586571-3586593 CCACCTATTCAGCAGGCAGAGGG - Intronic
1154477522 18:14777826-14777848 CCAGCTACTCAGGAGGCAGAAGG + Intronic
1156385304 18:36599155-36599177 CCCCATACCCAGACAGCAGAGGG - Intronic
1156466689 18:37352329-37352351 CCTCCTCCCCAGCCTGCAGAAGG + Intronic
1156749786 18:40438034-40438056 GCAACTAGCCAGGATGCAGAGGG - Intergenic
1157682137 18:49615458-49615480 CCACAGACACAGAAAGCAGAGGG - Intergenic
1158255970 18:55549184-55549206 CCAGCTACTCAGAAGGCTGAGGG + Intronic
1158465463 18:57686145-57686167 CCAGCTACCCAGGAAGCTGAGGG + Intronic
1158688361 18:59636036-59636058 CCAGCTACTCAGAAGGCTGAGGG + Intronic
1160168409 18:76532512-76532534 CCACCTGCCCAGAATCCACCTGG - Intergenic
1160516201 18:79480479-79480501 CCACCTCCCCAGGATGCTGGCGG - Intronic
1160853237 19:1204867-1204889 CCAGCTACTCAGAAGGCTGAGGG - Intronic
1161496047 19:4586408-4586430 CCACCTCCCCAGTATGCAGCAGG + Intergenic
1162753956 19:12846085-12846107 CCAGCTACACAGAAGGCAGAGGG + Intronic
1163900882 19:20099286-20099308 CCAGCTACTCAGGATGCTGAAGG - Intronic
1164025228 19:21345469-21345491 CCAGCTACTCAGGATGCTGAAGG - Intergenic
1166512998 19:43423271-43423293 CCAGCTACTCAGGAGGCAGAGGG - Intergenic
1167058367 19:47127816-47127838 CCAGCTACCCAGGAGGCTGAAGG - Intronic
1167286847 19:48603303-48603325 CCACCTGCCCAAAATGCAGCAGG + Intronic
1167404024 19:49292250-49292272 CCAGCTACTCAGAAGGCTGAGGG + Intronic
1168220979 19:54960268-54960290 CCAGCTACCCAGGAGGCTGAGGG - Intronic
1168495491 19:56844720-56844742 CCAGCTACCCAGGAGGCTGAGGG - Intergenic
925986063 2:9216147-9216169 CCACCTACCCAGAATTTTAAGGG + Intronic
926756654 2:16241873-16241895 CCACCCACACAGAATGAAGAGGG - Intergenic
927864528 2:26580196-26580218 CAGCCTAGGCAGAATGCAGAAGG - Intergenic
928108652 2:28489219-28489241 CCCCCTCCCCAGAATGGAGATGG + Intronic
928417801 2:31111149-31111171 CAGACTACCCAGGATGCAGATGG + Intronic
930182673 2:48379679-48379701 CCATCTACCCAGGAGGCTGAGGG + Intergenic
930444925 2:51458376-51458398 CCAGCTACCCAGCAGGCTGAAGG + Intergenic
930657673 2:54022494-54022516 CCAACTACTCAGAAGGCTGAGGG - Intronic
931056938 2:58482896-58482918 CCAGCTACTCAGGAGGCAGAGGG - Intergenic
931802584 2:65773069-65773091 CCAGCTACTCAGGATGCTGAGGG - Intergenic
931984047 2:67724422-67724444 CCACCTGCCCAAAGCGCAGAAGG + Intergenic
932579384 2:72983633-72983655 ACACCTACCCGGAGTCCAGAGGG + Intronic
935120521 2:100180000-100180022 CCCTCTAACCAGAAGGCAGAGGG - Intergenic
937047007 2:118857209-118857231 CCATCTATCCCGAAAGCAGAGGG - Intergenic
938247915 2:129793177-129793199 CCAGCTCCCCACAAAGCAGAGGG - Intergenic
939107914 2:137971292-137971314 CCAGCTACTCAGGATGCTGAGGG - Intronic
939410562 2:141819121-141819143 CCAGCTACTCAGGAGGCAGAGGG + Intronic
939685556 2:145194767-145194789 CCACCTACCCATAAATCATATGG - Intergenic
940297184 2:152139440-152139462 CCAGCTACCCAGGAGGCTGAGGG + Intronic
941383314 2:164822452-164822474 CCAACAACCCAGAAGGCATATGG - Intronic
942637835 2:178027680-178027702 CCTGCTACCCAGAATGCCAAAGG + Intronic
944317091 2:198295089-198295111 ACACCCAGCCAGAATCCAGAGGG + Intronic
947072009 2:226299033-226299055 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
947430568 2:230024197-230024219 CCAGCTACCCAGGAGGCTGAGGG - Intergenic
947800330 2:232925603-232925625 CCACACACCCACAGTGCAGAAGG + Intronic
947823823 2:233090840-233090862 CCAGCTACCCAGGAGGCTGAGGG + Intronic
948048833 2:234964397-234964419 TCCCCCACCCGGAATGCAGAGGG - Intronic
1168755618 20:315313-315335 CCAGCTACTCAGAAGGCTGAGGG - Intergenic
1170745965 20:19099168-19099190 CCACCTGCCCCGAAGGCAGCAGG - Intergenic
1171282734 20:23914648-23914670 CCACCCACACAGCATGCAGGAGG - Intergenic
1172266048 20:33615205-33615227 CCATGGACACAGAATGCAGATGG - Intronic
1172785076 20:37463405-37463427 CCAGCTACTCAGAAGGCTGAGGG - Intergenic
1174320120 20:49735111-49735133 CCAGCTACTCAGAAGGCTGAGGG - Intergenic
1177326155 21:19591827-19591849 CCACCTGCTCAGGAGGCAGAGGG - Intergenic
1177500365 21:21947200-21947222 CCACCTGCTCAGAAGGCTGAGGG + Intergenic
1179278399 21:39912560-39912582 ACACCTAGGCAGAATTCAGATGG - Intronic
1179651377 21:42811377-42811399 CCAGCTACTCAGGATGCTGAGGG - Intergenic
1180204352 21:46248359-46248381 GCAGCTCCCCAGAAAGCAGATGG + Intronic
1180253103 21:46602673-46602695 CAACCCAGCCAGAATTCAGAGGG - Intronic
1180631584 22:17233778-17233800 CCATCTACACAGACTGCAGAAGG + Intergenic
1181283070 22:21733611-21733633 CCAGCTACTCAGAAGGCAGGTGG + Intronic
1181448264 22:22996685-22996707 CCACCAACACAGACTGCACAGGG + Intergenic
1181978873 22:26752262-26752284 CCTCGGACACAGAATGCAGAGGG - Intergenic
1183052983 22:35279954-35279976 CCACAGACCCAGAATGGACAAGG - Intronic
1183468280 22:37991228-37991250 CCACCTACTCAGGAGGCTGAGGG - Intronic
1183590242 22:38775717-38775739 CCTCCTCCCCATACTGCAGATGG + Intronic
1183887204 22:40894055-40894077 CCAACTACCCAGGAGGCTGAGGG + Intronic
1183892515 22:40941585-40941607 CCAGCTACTCGGAATGCTGAAGG + Intergenic
1184360511 22:44014963-44014985 CCAGCTACTCAGAATGCTGAGGG - Intronic
1185020172 22:48369886-48369908 CCACCTTCCCAAGAGGCAGAGGG - Intergenic
1185207791 22:49550090-49550112 CAGCCTACCCAGAAAGCACAAGG + Intronic
949105681 3:197731-197753 CCACCTCCCCAGACCGCCGAGGG + Intronic
950272307 3:11627478-11627500 CCAGCTACCCAGGAGGCTGAGGG + Intronic
951725388 3:25752335-25752357 CCAGCTACTCAGAAAGCTGAGGG - Intronic
952265634 3:31783674-31783696 CCAGCTACTCAGGAGGCAGAGGG + Intronic
953071818 3:39527980-39528002 CCACCACCCCAAAATGCAGGCGG - Intronic
953168140 3:40483403-40483425 CCAGCTACTCAGAAGGCTGAGGG - Intronic
955372322 3:58363435-58363457 CCAGCTACTCAGGAGGCAGAGGG - Intronic
956765500 3:72481141-72481163 CCTCCCACGCAGAAGGCAGAAGG - Intergenic
957246272 3:77720756-77720778 TCTCTTACTCAGAATGCAGATGG + Intergenic
959723215 3:109515370-109515392 CCAGCTACTCAGAAGGCTGAGGG + Intergenic
962257468 3:133882374-133882396 CCTCCTCCCCAGAGTGCAGATGG - Intronic
963526551 3:146422414-146422436 CCACCCACCCAGCCTGCAGGTGG + Intronic
964624467 3:158746140-158746162 CCAGCTACTCAGAAGGCTGATGG - Intronic
965420257 3:168449061-168449083 TGACCTGACCAGAATGCAGATGG - Intergenic
966143851 3:176787690-176787712 CCACCCTCCCAGTGTGCAGATGG + Intergenic
966734630 3:183179277-183179299 CCAGCTACGCAGAAAGCAGCCGG - Exonic
967171746 3:186827419-186827441 CCAGCTACGCAGAAAGCAGCCGG + Intergenic
967971832 3:195004995-195005017 CCACCCACCCACAGTGCAGGTGG + Intergenic
968456186 4:701305-701327 CCATCTTCCCAGAATCCACAGGG + Intergenic
969263589 4:6049553-6049575 ATCCCTACCCAGAATGCAGGTGG - Intronic
969513309 4:7631934-7631956 GCACCTGCCCAGAAGGCAGCTGG - Intronic
969576453 4:8038816-8038838 CCAATTTCCCAGAAGGCAGAGGG - Intronic
969685084 4:8667063-8667085 CCACCTACTCGGGATGCTGAGGG - Intergenic
969854362 4:9987232-9987254 CCAGCTACCCAGGAAGCTGAGGG - Intronic
971961061 4:33487742-33487764 CCAGCTACTCAGGATGCTGAGGG - Intergenic
973344191 4:49036715-49036737 AAACCTACCCAGAAGCCAGAAGG - Intronic
975658327 4:76663642-76663664 CCAGCTACCCAGGAGGCTGAGGG - Intronic
975774156 4:77765694-77765716 ACACTAACCAAGAATGCAGAGGG - Intronic
975787758 4:77910675-77910697 CCATCTACCCAGAAGGCTAAGGG - Intronic
976660683 4:87537099-87537121 CAGCCTATCCAGAATGCAAATGG - Intergenic
977192710 4:94020863-94020885 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
980962181 4:139486197-139486219 CCACCTACCAGCTATGCAGAAGG - Intergenic
981562311 4:146061580-146061602 CCACATACCCAGAAAGCTGAGGG - Intergenic
981808601 4:148746741-148746763 CCAAGTACCCAGTATGCATAAGG + Intergenic
984821165 4:183883965-183883987 CCAGCTACTCAGGATGCTGAGGG - Intronic
984865046 4:184274051-184274073 CCTCCTCCCGAGAGTGCAGAAGG - Intergenic
986596460 5:9427548-9427570 GCACCAACCAAGAAGGCAGAAGG - Intronic
988799840 5:34686026-34686048 TCCCCTCCCCAGAATGCACAGGG - Intronic
990362298 5:55032615-55032637 CCACCTACTCAGGAGGCTGAGGG + Intronic
990457523 5:56002308-56002330 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
991710060 5:69400330-69400352 CCAGCTACTCAGAAGGCTGAGGG - Intronic
991919947 5:71646763-71646785 CCACACACCCAGAAAGCAGCAGG + Intronic
991983877 5:72262617-72262639 CCAACTCTCCAGAATGAAGAGGG + Intronic
992079166 5:73217844-73217866 CCACCTTCCAAGAATGAAGCTGG + Intergenic
993330609 5:86595248-86595270 CCAGCTACCCAGGATGCTGAAGG + Intergenic
996133052 5:119805503-119805525 CCACCTACCAAGATTGAAGCAGG - Intergenic
997159246 5:131589797-131589819 CCCCCTTACCAGGATGCAGATGG - Intronic
998864038 5:146476868-146476890 CCACCTACCCAGGAGGCAGGAGG - Intronic
999159683 5:149485070-149485092 CCAGCTACCCAGAAGGTGGAGGG - Intergenic
1000342003 5:160285073-160285095 CCAGCTACCCAGAAGGCTGAGGG + Intronic
1000510248 5:162172376-162172398 CCAGCTACTCAGAAGGCAAAGGG + Intergenic
1000937304 5:167318088-167318110 GCAGCAACACAGAATGCAGATGG + Intronic
1001144483 5:169171847-169171869 CAACCCACCCAGAATGCCTAAGG + Intronic
1001456380 5:171863677-171863699 ACACCTACCCAGAATGTCCAGGG - Exonic
1002866312 6:1125278-1125300 CCACCTACCCTCAGTCCAGAAGG + Intergenic
1003183225 6:3809600-3809622 ACAGCTACTCAGAAGGCAGAGGG - Intergenic
1004679044 6:17874549-17874571 CCAGCTACCCAGGAGGCTGAAGG - Intronic
1004898545 6:20172312-20172334 CCAGCTACCCAGGAGGCTGAGGG + Intronic
1004994246 6:21172640-21172662 CCAGCTACTCAGAAGGCTGAGGG + Intronic
1005318203 6:24624948-24624970 CCACCTACTCAGGAGGCTGAGGG + Intronic
1006000778 6:30963440-30963462 CCAGCTACTCAGGATGCTGAGGG - Intergenic
1006009675 6:31032009-31032031 CCATGTCCCCAGAATGCAGGTGG - Intronic
1006411774 6:33877978-33878000 CCAGGTACCCAGAATAAAGAAGG + Intergenic
1010209350 6:73350759-73350781 CCACCTACTCAGATGGCTGAGGG + Intergenic
1010576763 6:77541121-77541143 CCAGCTACTCAGAAGGCTGAGGG + Intergenic
1010982324 6:82382217-82382239 CCAGCTACTCAGGAGGCAGAGGG - Intergenic
1011433618 6:87314628-87314650 CCACTTGCCCAGAATGAAGGTGG - Intronic
1013275819 6:108583943-108583965 CCACCAACCCATACTGCTGAAGG - Intronic
1014256839 6:119169104-119169126 CCAGCTACCCAGGAGGCGGAGGG + Intergenic
1015047512 6:128794139-128794161 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
1015532798 6:134237560-134237582 CCAGCTACTCAGGAGGCAGAGGG + Intronic
1016480458 6:144475722-144475744 CCAGCTACCCAGGAGGCAGGAGG - Intronic
1018153031 6:160957872-160957894 ACACCTACCCAAAATGAAGGAGG + Intergenic
1018263406 6:161993377-161993399 CAACCTACCAAGAATGAAGTAGG + Intronic
1018786193 6:167109837-167109859 CTACCCAGCCAGAAAGCAGAAGG - Intergenic
1019693737 7:2432882-2432904 CGACCTTCCCAGAAAGGAGACGG + Exonic
1020448379 7:8294035-8294057 CCAGCTACTCAGAAGGCTGAGGG + Intergenic
1020483438 7:8691261-8691283 CCAGCTACTCAGAAGGCTGAGGG - Intronic
1022514937 7:30969488-30969510 CCAACTGCCCAGGATGGAGAGGG + Intronic
1023395916 7:39751884-39751906 CCAGCTACTCAGGAGGCAGAGGG + Intergenic
1023828506 7:44025485-44025507 CCAGCTACTCAGAAGGCTGAGGG + Intergenic
1025055856 7:55764333-55764355 CCAGCTACCCAGGAGGCTGAGGG + Intergenic
1025946160 7:66106512-66106534 CCACCTACTCAGGAGGCCGAGGG - Intronic
1026848726 7:73711942-73711964 CTACCTTCCCAGAAGGCTGAAGG + Intronic
1027265408 7:76492432-76492454 CCACGTACCCAGAGAGCAAAAGG - Intronic
1027316779 7:76990549-76990571 CCACGTACCCAGAGAGCAAAAGG - Intergenic
1029973139 7:104809008-104809030 CCAGCTACCCAGGAAGCTGAGGG - Intronic
1030576088 7:111287837-111287859 CCAACTATCCATCATGCAGAAGG - Intronic
1031085473 7:117298042-117298064 CCACCTGCCCTGACTGCAGCAGG + Intronic
1031875325 7:127133015-127133037 CCAGCTACTCAGGAAGCAGAAGG + Intronic
1033621844 7:143069054-143069076 TCACCCACCGGGAATGCAGAGGG + Intergenic
1034116476 7:148588429-148588451 CCACATGCACAGAATACAGAAGG - Intergenic
1034711011 7:153191535-153191557 TCATCTACCCAGAGGGCAGAGGG - Intergenic
1037632804 8:20673495-20673517 CTAGCTACTCAGCATGCAGACGG - Intergenic
1038433129 8:27515726-27515748 CCAGCTCCACAAAATGCAGACGG - Exonic
1038525224 8:28267470-28267492 CCAGGTACCCAGCATGGAGAGGG + Intergenic
1038552552 8:28482521-28482543 GCACCTTCCCAGAGTGCAGGTGG + Intronic
1038949095 8:32394251-32394273 CCAGCTACTCAGCATGGAGATGG - Intronic
1039109001 8:34021387-34021409 CCAGCTACTCAGAAGGCTGAGGG + Intergenic
1039851683 8:41372289-41372311 CCAGCTACTCAGAAGGCTGAGGG + Intergenic
1040048818 8:42991515-42991537 CCAGCTACTCAGAAGGCTGAGGG - Intronic
1041684589 8:60631678-60631700 CCAGCTACTCAGAAGGCTGAGGG - Intergenic
1042058566 8:64792335-64792357 CCACCTATCCAGATTGCAGAAGG + Intronic
1042390546 8:68228827-68228849 CCACCTACTCAGGAGACAGATGG + Intronic
1045836707 8:106530404-106530426 CCAGCTACCCTGGAGGCAGAAGG - Intronic
1047286140 8:123488806-123488828 CTAGCTACTCAGCATGCAGAAGG - Intergenic
1047812972 8:128430227-128430249 CAAACTATCCAGAATCCAGATGG - Intergenic
1049057813 8:140252852-140252874 CCACCTTCCCAGGCTGCAAAGGG + Exonic
1049145238 8:140995692-140995714 CCAGCTACTCAGGAGGCAGAAGG + Intronic
1051076991 9:13251012-13251034 CCAGCTACTCAGGATGCGGAGGG + Intronic
1051909246 9:22134138-22134160 CCTCCTACCCAGGATGGGGAAGG + Intergenic
1053064286 9:35056714-35056736 CCACCTACCCAGGTTGGATAGGG + Exonic
1053095589 9:35325227-35325249 TCAACTGCCCAGAATGCAAAAGG - Intronic
1057552673 9:96063522-96063544 CCACCCACCCAGTGTGCTGAAGG + Intergenic
1057930131 9:99185812-99185834 CCAGCTACTCAGAAGGCAGGAGG - Intergenic
1059938671 9:119336744-119336766 CCATCTACTCTGTATGCAGAGGG + Intronic
1060604400 9:124901084-124901106 CCAGCTACTCAGAAGGCTGAGGG - Intronic
1060969957 9:127732275-127732297 CCACCTACCCTTCCTGCAGATGG - Exonic
1061105612 9:128528117-128528139 CCAGCTACTCAGAAGGCTGAGGG - Intronic
1061415286 9:130444295-130444317 GCACCTGCCCAGACTCCAGAGGG - Intergenic
1061440700 9:130601448-130601470 CCCACTACACAGAATGCAGGGGG - Intronic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1188814146 X:34690324-34690346 CCACCTACCAAGATTGAACAAGG - Intergenic
1190782802 X:53614669-53614691 CCATCAATCCAGAAGGCAGATGG - Exonic
1192635180 X:72808852-72808874 CCACCTACTCAGGAGGCTGAGGG + Intronic
1192646535 X:72911951-72911973 CCACCTACTCAGGAGGCTGAGGG - Intronic
1194734502 X:97496288-97496310 CCAGCTACTCAGAAGGCTGAGGG - Intronic
1194846363 X:98814331-98814353 CCAGCTACCCAGGAGGCTGAGGG - Intergenic
1196679925 X:118460298-118460320 CCAGCTACTCAGAAGGCTGAGGG + Intergenic
1197938622 X:131765552-131765574 CCAGCTACTCAGAAGGCTGAGGG - Intergenic
1200042223 X:153378900-153378922 GCAGCTACCCCAAATGCAGATGG + Intergenic
1200110204 X:153737085-153737107 CAGACTCCCCAGAATGCAGAGGG + Intronic
1200406833 Y:2820694-2820716 CCAGCTACTCAGAAGGCTGAGGG - Intergenic
1200767852 Y:7095666-7095688 CCTCCTTCATAGAATGCAGATGG - Intergenic
1201219471 Y:11754124-11754146 GGACTTACCCAGAATGCAGCAGG - Intergenic