ID: 1139962290

View in Genome Browser
Species Human (GRCh38)
Location 16:70724944-70724966
Sequence TCTAGCAAACAGACTTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139962283_1139962290 12 Left 1139962283 16:70724909-70724931 CCATCTGCATTCTGGGTAGGTGG 0: 1
1: 0
2: 1
3: 23
4: 344
Right 1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 84
1139962282_1139962290 13 Left 1139962282 16:70724908-70724930 CCCATCTGCATTCTGGGTAGGTG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139962290 Original CRISPR TCTAGCAAACAGACTTAGGT TGG Intronic
913029070 1:114879486-114879508 TTTAGCCAACAGACTTGGGGTGG - Intronic
920693583 1:208164914-208164936 GTTAGCAAAGAGGCTTAGGTGGG + Intronic
921431387 1:215070112-215070134 TATAGGAAACAGGTTTAGGTTGG + Intronic
1063882256 10:10543109-10543131 TCTAGCAAACAGATGTCTGTTGG + Intergenic
1071189661 10:83084329-83084351 TCTGGAAAACACACTTTGGTGGG + Intergenic
1078240866 11:9529889-9529911 GCTAGCAAACAGAACCAGGTGGG + Intergenic
1080085149 11:28271368-28271390 TCCAGGAAACCTACTTAGGTTGG + Intronic
1080337207 11:31211156-31211178 TTTAGCAATCAGACTGAGCTTGG + Intronic
1081585212 11:44379633-44379655 ACTCCCACACAGACTTAGGTTGG + Intergenic
1084376539 11:68782092-68782114 TCCAGCAAACAGTCTCAGATGGG - Intronic
1087219425 11:95530315-95530337 TCTAGGAAACAGACTCAAGTGGG + Intergenic
1088270946 11:108033919-108033941 GCTAGCAAACAGAATTAGTGGGG - Intronic
1093535350 12:20216884-20216906 TCTATCAAACAGACTTTCATTGG - Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1097146838 12:56947254-56947276 TCTAGAAAACAGACTTAAAAGGG - Intergenic
1099947186 12:89258123-89258145 TCTAGAAAATAGGCTTAGATGGG - Intergenic
1101929861 12:109005218-109005240 TCTGGCAAACAGACTGACTTGGG + Intronic
1103279029 12:119739242-119739264 CCTCTAAAACAGACTTAGGTAGG + Intronic
1107406701 13:40121430-40121452 TTTAGCAAACAAACTGTGGTAGG + Intergenic
1110850508 13:80239508-80239530 TTTGGCAAACAGAAATAGGTTGG + Intergenic
1114815517 14:25953474-25953496 TATACCAAATAGACTTAGGAGGG + Intergenic
1114891438 14:26929005-26929027 TCTAGCAACCAGAGTGAGCTTGG + Intergenic
1117575034 14:57089020-57089042 TCTAGGGAACACACTTAGGTTGG + Intergenic
1121202277 14:92128320-92128342 TCTACCAAAAAGAATTAGCTGGG + Intronic
1122241783 14:100373371-100373393 TGAAGAAAACAGACTAAGGTTGG - Intronic
1123485871 15:20737992-20738014 TTTTGCAAACTGAATTAGGTAGG - Intergenic
1123542360 15:21307036-21307058 TTTTGCAAACTGAATTAGGTAGG - Intergenic
1125133682 15:36314964-36314986 TCTTGCAAACAGACTCAGATGGG - Intergenic
1126407533 15:48336774-48336796 TCTAGCACACCTACTTATGTGGG - Intronic
1128368787 15:67024095-67024117 TCCAGGAAACAGACCCAGGTAGG + Intergenic
1130820262 15:87487725-87487747 TCTAGCCAACAGACTAAGTAAGG + Intergenic
1202950677 15_KI270727v1_random:34177-34199 TTTTGCAAACTGAATTAGGTAGG - Intergenic
1137345131 16:47650522-47650544 TCTGTCAAACAGAATGAGGTAGG - Exonic
1138959539 16:62012106-62012128 TCTAGCAAACATTCTTAGCCAGG + Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1143740143 17:8946542-8946564 TTGAGTAAACACACTTAGGTTGG - Intronic
1149312591 17:55409369-55409391 TCTAGAAAACAGAATTAGAAAGG - Intronic
1156703512 18:39852822-39852844 TCTAGCAAACAGAAATATTTGGG - Intergenic
1160899919 19:1422489-1422511 TGTAGCAAACAGCCTCAGGAAGG + Intronic
1162504655 19:11076064-11076086 TCTGGGGAACAGAGTTAGGTCGG + Intergenic
1162679493 19:12329874-12329896 TCCAGAAAACAGAAGTAGGTAGG + Intronic
1166359274 19:42245947-42245969 GCTAGCTAATAGATTTAGGTGGG + Intronic
928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG + Intronic
930265396 2:49193864-49193886 CCTACCAAACAGACTAAGATTGG - Intergenic
931601345 2:64006467-64006489 ATTAGGAAACAGACTTAGGAAGG - Intronic
937353658 2:121184793-121184815 TCCAGGACTCAGACTTAGGTGGG - Intergenic
939019096 2:136937907-136937929 TCAAGCATATAGCCTTAGGTAGG + Intronic
941494521 2:166183213-166183235 TCTAGTAACCACACTTAGGAGGG - Intergenic
942071962 2:172324386-172324408 TCCAGGAAACAGACTCAGGGAGG + Intergenic
945793247 2:214331264-214331286 TATAGCAAACATAGGTAGGTAGG + Intronic
948293386 2:236843822-236843844 TCTGGCAAAAAGACTTCTGTAGG + Intergenic
1170878978 20:20277998-20278020 TCTAGCAAATAGAATGTGGTGGG - Intronic
1173045390 20:39504709-39504731 TTGAGCCAACAGACTTGGGTTGG + Intergenic
1176028850 20:63000699-63000721 TTTATGAAACAGACTTTGGTTGG + Intergenic
1180013155 21:45064670-45064692 TCTAGAAAACAAAAATAGGTGGG + Intergenic
1182382157 22:29900345-29900367 TTTTGCAAACTGAATTAGGTAGG + Intronic
952713799 3:36457877-36457899 AATAGCAAATAGAGTTAGGTTGG - Intronic
954277069 3:49549256-49549278 TCTATGAAACAGACATGGGTGGG + Intergenic
954358333 3:50102124-50102146 ACTATCAAACAGATTTAAGTAGG - Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956896065 3:73661184-73661206 ACTATCAAACAGCCTCAGGTAGG - Intergenic
958966300 3:100562654-100562676 GCTAGCATACAGATTCAGGTTGG - Intronic
959388443 3:105742179-105742201 TATAGCCAACAGATTTAAGTTGG - Intronic
970176070 4:13340716-13340738 TCTAGCAAACAGATTTCTGTGGG - Intergenic
972999219 4:44925014-44925036 GATACCTAACAGACTTAGGTGGG - Intergenic
975370265 4:73577973-73577995 TCTGGAAAACAGAGATAGGTGGG - Intronic
975789023 4:77927857-77927879 TCTAGAAAACAAGCTTAGATTGG - Intronic
984251735 4:177344163-177344185 TGTAGAAAACAGAATCAGGTCGG - Intronic
987430781 5:17830497-17830519 TCTAGGAAACAGACTTCTGGAGG + Intergenic
993709421 5:91209608-91209630 TCTACAAAACAGCCTCAGGTAGG - Intergenic
1000454546 5:161433496-161433518 GCTACCCAAGAGACTTAGGTGGG + Intronic
1000739753 5:164953363-164953385 TCTTGCAAACAGTTTTATGTAGG + Intergenic
1001253927 5:170169369-170169391 TGGAGCAAACAGACTTCGGGTGG + Intergenic
1004673221 6:17816838-17816860 TATAGTAAACATACTTAGGGTGG + Intronic
1007036848 6:38682211-38682233 ACTTGGGAACAGACTTAGGTAGG + Intronic
1011002600 6:82607733-82607755 TTTAGGAAACAGACTCAGGGAGG + Intergenic
1012012212 6:93803580-93803602 TCTAGCAAAAAGATTTTGTTTGG + Intergenic
1012975454 6:105777035-105777057 TCTAGCAAATAAACTTAGTGAGG + Intergenic
1013648264 6:112167419-112167441 TTTAGAAAACAAACTTAAGTGGG - Intronic
1016838063 6:148498955-148498977 TCTAATAAGCAGGCTTAGGTTGG - Intronic
1024022987 7:45387871-45387893 TGTAGCAAGCAGAGTTGGGTGGG - Intergenic
1026463257 7:70632806-70632828 CCGAGCAAACAGACTTCTGTGGG + Intronic
1050736488 9:8769033-8769055 GCTAACACACAGAATTAGGTGGG - Intronic
1054729876 9:68690539-68690561 TTTTGCAAAAAGACTTACGTTGG - Intergenic
1055222915 9:73959594-73959616 AGTAGAAAACAAACTTAGGTTGG - Intergenic
1188845303 X:35065096-35065118 TGTAGCAAGCAGTCTAAGGTAGG - Intergenic
1193367146 X:80648788-80648810 CCTAGCAAGTAGACTTAGATGGG + Intergenic
1195382671 X:104285496-104285518 TCTATCAAAAAGACTCAGCTAGG - Intergenic
1196406401 X:115367013-115367035 TCTGGGAAAGAGACTTAGATCGG + Intergenic
1198560179 X:137841151-137841173 TCTTGCCCACAGACTCAGGTTGG - Intergenic
1198993626 X:142546714-142546736 TTAAGCAAAAAGACTTAGGTTGG - Intergenic
1199829683 X:151537242-151537264 CCTAGTAAACAGACATAGGTGGG + Intergenic