ID: 1139964332

View in Genome Browser
Species Human (GRCh38)
Location 16:70737202-70737224
Sequence GCTCTTGTAAGCAGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139964325_1139964332 1 Left 1139964325 16:70737178-70737200 CCCACCTCCGGCTCTGGCTCATC 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1139964332 16:70737202-70737224 GCTCTTGTAAGCAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1139964328_1139964332 -6 Left 1139964328 16:70737185-70737207 CCGGCTCTGGCTCATCTGCTCTT 0: 1
1: 0
2: 7
3: 36
4: 330
Right 1139964332 16:70737202-70737224 GCTCTTGTAAGCAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1139964319_1139964332 27 Left 1139964319 16:70737152-70737174 CCGCCTCACTGCTGCCTGCTCTT 0: 1
1: 0
2: 11
3: 75
4: 651
Right 1139964332 16:70737202-70737224 GCTCTTGTAAGCAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1139964320_1139964332 24 Left 1139964320 16:70737155-70737177 CCTCACTGCTGCCTGCTCTTCCG 0: 1
1: 0
2: 0
3: 34
4: 406
Right 1139964332 16:70737202-70737224 GCTCTTGTAAGCAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1139964327_1139964332 -3 Left 1139964327 16:70737182-70737204 CCTCCGGCTCTGGCTCATCTGCT 0: 1
1: 0
2: 3
3: 11
4: 242
Right 1139964332 16:70737202-70737224 GCTCTTGTAAGCAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1139964326_1139964332 0 Left 1139964326 16:70737179-70737201 CCACCTCCGGCTCTGGCTCATCT 0: 1
1: 0
2: 2
3: 18
4: 315
Right 1139964332 16:70737202-70737224 GCTCTTGTAAGCAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1139964321_1139964332 13 Left 1139964321 16:70737166-70737188 CCTGCTCTTCCGCCCACCTCCGG 0: 1
1: 0
2: 1
3: 12
4: 243
Right 1139964332 16:70737202-70737224 GCTCTTGTAAGCAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1139964324_1139964332 4 Left 1139964324 16:70737175-70737197 CCGCCCACCTCCGGCTCTGGCTC 0: 1
1: 0
2: 5
3: 66
4: 713
Right 1139964332 16:70737202-70737224 GCTCTTGTAAGCAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139964332 Original CRISPR GCTCTTGTAAGCAGGGTCCT GGG Intronic