ID: 1139965673

View in Genome Browser
Species Human (GRCh38)
Location 16:70744126-70744148
Sequence AGACCAGCAGCCGACCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139965667_1139965673 17 Left 1139965667 16:70744086-70744108 CCCCTGGATTCCAGACTGGAGAG 0: 1
1: 0
2: 7
3: 184
4: 3652
Right 1139965673 16:70744126-70744148 AGACCAGCAGCCGACCCAGATGG 0: 1
1: 0
2: 0
3: 7
4: 109
1139965664_1139965673 29 Left 1139965664 16:70744074-70744096 CCAAGACCGAAGCCCCTGGATTC 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1139965673 16:70744126-70744148 AGACCAGCAGCCGACCCAGATGG 0: 1
1: 0
2: 0
3: 7
4: 109
1139965669_1139965673 15 Left 1139965669 16:70744088-70744110 CCTGGATTCCAGACTGGAGAGAT 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1139965673 16:70744126-70744148 AGACCAGCAGCCGACCCAGATGG 0: 1
1: 0
2: 0
3: 7
4: 109
1139965663_1139965673 30 Left 1139965663 16:70744073-70744095 CCCAAGACCGAAGCCCCTGGATT 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1139965673 16:70744126-70744148 AGACCAGCAGCCGACCCAGATGG 0: 1
1: 0
2: 0
3: 7
4: 109
1139965670_1139965673 7 Left 1139965670 16:70744096-70744118 CCAGACTGGAGAGATGCTGCCTA 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1139965673 16:70744126-70744148 AGACCAGCAGCCGACCCAGATGG 0: 1
1: 0
2: 0
3: 7
4: 109
1139965668_1139965673 16 Left 1139965668 16:70744087-70744109 CCCTGGATTCCAGACTGGAGAGA 0: 1
1: 0
2: 2
3: 16
4: 273
Right 1139965673 16:70744126-70744148 AGACCAGCAGCCGACCCAGATGG 0: 1
1: 0
2: 0
3: 7
4: 109
1139965665_1139965673 23 Left 1139965665 16:70744080-70744102 CCGAAGCCCCTGGATTCCAGACT 0: 1
1: 0
2: 3
3: 29
4: 349
Right 1139965673 16:70744126-70744148 AGACCAGCAGCCGACCCAGATGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139965673 Original CRISPR AGACCAGCAGCCGACCCAGA TGG Intronic