ID: 1139967921

View in Genome Browser
Species Human (GRCh38)
Location 16:70755879-70755901
Sequence CCCCTAGGTTCCCAGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 246}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139967921_1139967936 26 Left 1139967921 16:70755879-70755901 CCAGCCACCTGGGAACCTAGGGG 0: 1
1: 0
2: 0
3: 20
4: 246
Right 1139967936 16:70755928-70755950 ACAGCACAGCTCGGGGGTTTGGG 0: 1
1: 0
2: 2
3: 7
4: 106
1139967921_1139967930 17 Left 1139967921 16:70755879-70755901 CCAGCCACCTGGGAACCTAGGGG 0: 1
1: 0
2: 0
3: 20
4: 246
Right 1139967930 16:70755919-70755941 CCATTCCTCACAGCACAGCTCGG 0: 1
1: 0
2: 2
3: 27
4: 253
1139967921_1139967935 25 Left 1139967921 16:70755879-70755901 CCAGCCACCTGGGAACCTAGGGG 0: 1
1: 0
2: 0
3: 20
4: 246
Right 1139967935 16:70755927-70755949 CACAGCACAGCTCGGGGGTTTGG 0: 1
1: 0
2: 4
3: 13
4: 173
1139967921_1139967937 27 Left 1139967921 16:70755879-70755901 CCAGCCACCTGGGAACCTAGGGG 0: 1
1: 0
2: 0
3: 20
4: 246
Right 1139967937 16:70755929-70755951 CAGCACAGCTCGGGGGTTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 152
1139967921_1139967932 19 Left 1139967921 16:70755879-70755901 CCAGCCACCTGGGAACCTAGGGG 0: 1
1: 0
2: 0
3: 20
4: 246
Right 1139967932 16:70755921-70755943 ATTCCTCACAGCACAGCTCGGGG 0: 1
1: 0
2: 1
3: 16
4: 124
1139967921_1139967931 18 Left 1139967921 16:70755879-70755901 CCAGCCACCTGGGAACCTAGGGG 0: 1
1: 0
2: 0
3: 20
4: 246
Right 1139967931 16:70755920-70755942 CATTCCTCACAGCACAGCTCGGG 0: 1
1: 0
2: 1
3: 26
4: 249
1139967921_1139967933 20 Left 1139967921 16:70755879-70755901 CCAGCCACCTGGGAACCTAGGGG 0: 1
1: 0
2: 0
3: 20
4: 246
Right 1139967933 16:70755922-70755944 TTCCTCACAGCACAGCTCGGGGG 0: 1
1: 0
2: 1
3: 26
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139967921 Original CRISPR CCCCTAGGTTCCCAGGTGGC TGG (reversed) Intronic
900693899 1:3998296-3998318 CCCCTAGGAGACCAAGTGGCCGG + Intergenic
901175052 1:7292992-7293014 CCCCAGGATTCCCAGGAGGCAGG - Intronic
902739557 1:18426130-18426152 GCCCCAGCCTCCCAGGTGGCTGG - Intergenic
903453211 1:23469190-23469212 ACCTTAGCTTCCCAAGTGGCTGG - Intronic
903888346 1:26554266-26554288 CCCCTGGGTCCCGAGGGGGCAGG - Intronic
904218432 1:28943537-28943559 CTCCTAGTCTCCCAGGTAGCTGG - Intronic
904681574 1:32233106-32233128 GCCTTAGCTTCCCAAGTGGCTGG + Intergenic
904697983 1:32341145-32341167 CCCCTAGCCTCCCAAGTAGCTGG - Intergenic
904881802 1:33704875-33704897 GCCCTAGCTTCCCAAGTAGCTGG + Intronic
905553032 1:38859356-38859378 CTCCCCGGTTCTCAGGTGGCCGG - Intronic
908280245 1:62526049-62526071 ACCTTAGCTTCCCAGGTAGCTGG + Intronic
908432908 1:64076289-64076311 CCCATAGATTCCCTGGTGGATGG + Intronic
911644088 1:100320347-100320369 ACCCCAGGTGCCCAGGTGGAAGG + Intergenic
913368176 1:118066295-118066317 CCCCTAGGCTCTCAGTTTGCTGG + Intronic
914711782 1:150221322-150221344 GCCCCAGCCTCCCAGGTGGCTGG - Intronic
915598423 1:156908113-156908135 CAGCTAGGTGCCCAGGTGCCGGG + Exonic
923498470 1:234544916-234544938 CTCCTGCCTTCCCAGGTGGCCGG + Intergenic
924649968 1:245917144-245917166 CCCTCAGCTTCCCAGGTAGCTGG + Intronic
1062772363 10:112866-112888 CCCATAGGTTCCCAGGGTGTTGG + Intergenic
1062829604 10:596973-596995 CCCCGGGGTGCCCAGGTGGCTGG + Intronic
1063267704 10:4472909-4472931 GCCTTAGGCTCCCAGGTAGCTGG + Intergenic
1063985619 10:11498467-11498489 CCCCAAGGTTAGCAAGTGGCAGG - Intronic
1064209366 10:13349669-13349691 CCCCCAGGTTTCCAGTTTGCGGG + Intergenic
1064271746 10:13871813-13871835 CCTCTGGGTCCCCAGGTAGCTGG - Intronic
1070004977 10:72415128-72415150 GCCTTAGCTTCCCAAGTGGCTGG + Intronic
1070159861 10:73859832-73859854 CCCCTGGCTTCCCAGGTCTCGGG - Intronic
1074318695 10:112381267-112381289 CCCATAAGTACCCAGATGGCAGG + Intronic
1074816644 10:117146920-117146942 GCCCCAGTTTCCCAAGTGGCTGG + Intergenic
1075077949 10:119363813-119363835 CCCCTAGCTGCAGAGGTGGCAGG + Intronic
1076017536 10:127040128-127040150 CCAACAGGCTCCCAGGTGGCAGG - Intronic
1076467986 10:130698143-130698165 CCCCTAGTTCTCCAAGTGGCTGG + Intergenic
1077344355 11:2039496-2039518 CCCCCAGGTTCCCAGGGCACAGG + Intergenic
1079226843 11:18614305-18614327 ACCTTAGCTTCCCAGGTAGCTGG - Intronic
1080446950 11:32346122-32346144 CCATTGGGTTCCCAGATGGCAGG + Intergenic
1082626896 11:55497184-55497206 AACCTAGGTGCCAAGGTGGCAGG + Intergenic
1083298260 11:61726884-61726906 CCCCGAGGTTCCCTGGTGGGCGG + Intronic
1083867391 11:65463862-65463884 CTCCCAAGTTCCCAGGTAGCTGG - Intergenic
1084669391 11:70596306-70596328 CCTCTTGGTTCCCAGGCGCCAGG - Intronic
1084710408 11:70840524-70840546 CCCCTAGAATCCCAGGAGTCAGG - Intronic
1085333669 11:75673325-75673347 CCCTTAGCCTCCCAAGTGGCTGG + Intergenic
1088660801 11:112044307-112044329 GCCCCAGCCTCCCAGGTGGCTGG + Intronic
1090212008 11:124927562-124927584 CACCTTGTTGCCCAGGTGGCTGG + Intronic
1202827341 11_KI270721v1_random:94685-94707 CCCCCAGGTTCCCAGGGCACAGG + Intergenic
1094311017 12:29083115-29083137 CCCTCAGCCTCCCAGGTGGCTGG + Intergenic
1095173363 12:39061022-39061044 CTCCCAAGTTCCCAAGTGGCTGG + Intergenic
1096112720 12:49038789-49038811 GCCCTAGGTTCCCCGTTGGCGGG - Exonic
1096252390 12:50041398-50041420 CACCAGGGTCCCCAGGTGGCAGG - Intergenic
1097918206 12:65042130-65042152 CCCCTAGGTGTCCAGGCTGCAGG + Intergenic
1098830633 12:75357923-75357945 CCCCTAGTTTCTTAGGTGGAAGG - Intronic
1101000167 12:100349554-100349576 CCCCCAGCTTCCCAGGTAGCTGG - Intergenic
1102236168 12:111296052-111296074 CCCCGAGGTTCCAACCTGGCAGG - Intronic
1102611993 12:114120454-114120476 CACCTGGGTTTCCACGTGGCTGG - Intergenic
1102885378 12:116517869-116517891 TCCCTGTGGTCCCAGGTGGCAGG + Intergenic
1103085620 12:118060660-118060682 CCCCTGGGTACCCAGGTGCCAGG - Intronic
1104840596 12:131823224-131823246 GCCTTAGCTTCCCAGGTAGCTGG - Intergenic
1104868419 12:131975806-131975828 ACCTTAGGTTCCCAAATGGCTGG + Intronic
1110558771 13:76887511-76887533 TCCCTGGCTTCCCAGGTGGGTGG + Intergenic
1111107435 13:83665819-83665841 CCCTTAGTCTCCCAGGTTGCTGG - Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1114146892 14:19987859-19987881 GCCGTAGGCTCCCAAGTGGCTGG + Intergenic
1115210188 14:30959704-30959726 CCCCCAGCTTCCCAAGTAGCTGG - Intronic
1116586498 14:46711622-46711644 CCCCTAGCCTCCCCAGTGGCTGG + Intergenic
1117112651 14:52475039-52475061 CCTTTAGGTTCCCCGGTGGTGGG - Intronic
1118188521 14:63559340-63559362 GCCTTAGCTTCCCAGGTAGCTGG - Intergenic
1118451906 14:65910704-65910726 CCGCTAGGTGCCCAACTGGCTGG - Intergenic
1118724344 14:68618158-68618180 CATCTGTGTTCCCAGGTGGCTGG + Intronic
1119216750 14:72875290-72875312 ACCCCAGCTTCCCAAGTGGCTGG - Intronic
1120980545 14:90285414-90285436 GCCTTAGCCTCCCAGGTGGCTGG + Intronic
1121361095 14:93260666-93260688 GCCTCAGCTTCCCAGGTGGCAGG + Intronic
1121653378 14:95576429-95576451 TCTCTAGGTTCCCATGGGGCTGG - Intergenic
1121843610 14:97154844-97154866 CTCCTAGCTGCCCGGGTGGCAGG + Intergenic
1122847319 14:104506939-104506961 CCCCCAGGTTGCCATGGGGCTGG + Intronic
1124235272 15:27984513-27984535 CCACCAGGTGCCCAGGTGCCAGG - Intronic
1125963084 15:43848821-43848843 GCCTTAGTTTCCCAAGTGGCTGG - Intronic
1126624336 15:50671693-50671715 ACCTTAGCTTCCCAGGTAGCTGG - Intronic
1129890040 15:79065781-79065803 TCCCTCGGTGTCCAGGTGGCAGG + Intronic
1131151009 15:90047164-90047186 GCCCCAGTTTCCCAGGTGGCAGG + Intronic
1132593886 16:739484-739506 CCCCCAGCCTCCCAGATGGCAGG + Intronic
1132848600 16:2013014-2013036 GCCTTAGGTTCCCAAGTAGCTGG - Intronic
1133439084 16:5805649-5805671 CCCCTAGGGTTCCAGGGGGAAGG + Intergenic
1134066473 16:11231726-11231748 CCCCTCGGATGCCAGGTGGTAGG + Intergenic
1135313273 16:21422005-21422027 CTCCTGGGTCCCCAGGGGGCAGG + Intronic
1135366197 16:21854283-21854305 CTCCTGGGTCCCCAGGGGGCAGG + Intronic
1135445618 16:22516881-22516903 CTCCTGGGTCCCCAGGGGGCAGG - Intronic
1136136381 16:28259100-28259122 CACCTGGATTCCGAGGTGGCTGG - Intergenic
1136309942 16:29400720-29400742 CTCCTGGGTCCCCAGGGGGCAGG + Intronic
1138340667 16:56287079-56287101 CCCCTGAGGTCCCAGGTGGCAGG + Intronic
1138438828 16:57022262-57022284 CCCCTCAGCTCCCAGCTGGCTGG - Exonic
1139857627 16:69993110-69993132 CTCCTGGGTCCCCAGGGGGCAGG + Intergenic
1139967921 16:70755879-70755901 CCCCTAGGTTCCCAGGTGGCTGG - Intronic
1141303082 16:82836261-82836283 CCCTTAGCTTCCCAAGTAGCTGG + Intronic
1141507948 16:84491721-84491743 GCCTTAGCTTCCCAAGTGGCTGG - Intronic
1142000213 16:87660053-87660075 TCCCAGGGTTTCCAGGTGGCAGG - Intronic
1142217440 16:88836785-88836807 CCCCCATCTTCCCATGTGGCAGG - Intronic
1142291038 16:89193637-89193659 CCCCAAGGAACCCAGGTCGCGGG + Intronic
1142855749 17:2728771-2728793 CCTCTTGGTGCCTAGGTGGCTGG - Intergenic
1143112661 17:4560867-4560889 TCCCTAGAGTCCCAGGTGGGTGG - Intergenic
1144685841 17:17225764-17225786 GCCTTAGCCTCCCAGGTGGCTGG - Intronic
1144813577 17:18017813-18017835 CCTCTAGTGTCCCAGGAGGCAGG - Intronic
1147193535 17:38750171-38750193 CCCCCAGGTGCCCATGTGGTTGG - Exonic
1147630101 17:41924712-41924734 CCTCCAGCTTCCCTGGTGGCAGG - Intronic
1147673670 17:42190977-42190999 CCCATAGGGCCCCAGGTAGCAGG + Intronic
1147841843 17:43377419-43377441 ATCCTACCTTCCCAGGTGGCTGG - Intergenic
1150283592 17:63943452-63943474 CCACTGGGGTCCCAGGTGGGAGG + Intronic
1150980801 17:70139363-70139385 GCCTTAGCCTCCCAGGTGGCTGG - Intergenic
1152096693 17:78276778-78276800 CACCTGGGTCCCCAGGTGGGAGG + Intergenic
1152188941 17:78876460-78876482 GCCTTAGCTTCCCAGGTAGCTGG + Intronic
1152291635 17:79443150-79443172 TCCTCGGGTTCCCAGGTGGCTGG - Intronic
1154489902 18:14913315-14913337 CCCTTAGGTGCACAGATGGCTGG - Intergenic
1156750978 18:40454645-40454667 GCCTCAGTTTCCCAGGTGGCTGG - Intergenic
1157425473 18:47580752-47580774 CCCCTAGGTGCCCTAGTGCCTGG + Intergenic
1159213227 18:65356906-65356928 CCCTTAGTCTCCCAGGTAGCTGG - Intergenic
1161133917 19:2608569-2608591 CCTCCAGGTTTCCAGGTTGCTGG - Intronic
1161463105 19:4410734-4410756 GCCTCAGTTTCCCAGGTGGCTGG - Intronic
1162084597 19:8240933-8240955 CAGTTTGGTTCCCAGGTGGCAGG + Intronic
1162789212 19:13054430-13054452 TCCCTGGGTTCCTAGGGGGCTGG + Intronic
1165319566 19:35076891-35076913 GCCCTGGGGACCCAGGTGGCAGG - Intergenic
1165435615 19:35793172-35793194 CCCTTAGGTGTCCAGGTGGACGG - Intergenic
1165500983 19:36189172-36189194 ACCTCAGGTTCCCAAGTGGCTGG - Intronic
1166222855 19:41376776-41376798 CCCCTTGGATCCTCGGTGGCAGG + Exonic
1166230692 19:41424553-41424575 CCCGTAGGTCTGCAGGTGGCGGG - Exonic
1166974239 19:46594672-46594694 GCCTTAGGCTCCCAGGTAGCTGG - Intronic
1167103500 19:47418162-47418184 CCCCTGGCTTCCCAGGTGCATGG - Intronic
1167743257 19:51337313-51337335 TCCCTGGGTTCCGAGGTGGAAGG + Exonic
926453831 2:13040221-13040243 CCCCGAGTTTCCCAGGGGGCAGG + Intergenic
926751945 2:16204942-16204964 CCCCAAGGTTCCCTGATGGGAGG - Intergenic
926753568 2:16218818-16218840 CCCCGAGGTTCCCTGCTGGCTGG - Intergenic
927001090 2:18794597-18794619 CCCTCAGGTTCCCAGGCAGCAGG + Intergenic
928573567 2:32631923-32631945 CCCTCAGGTTCCCATGTAGCTGG + Intronic
932153889 2:69397797-69397819 GCCTTAGCTTCCCAGGTAGCTGG - Intronic
932192197 2:69750525-69750547 ACCTTAGCCTCCCAGGTGGCTGG + Intronic
933042652 2:77488055-77488077 CCCCTAGCTTGCCATGTTGCAGG + Intronic
934916660 2:98305736-98305758 CCCCTTGGTCTCCAGGTTGCAGG + Intronic
935378648 2:102426189-102426211 CCCCCAGGTTCTCAGGTGGTGGG + Intronic
936589068 2:113785643-113785665 ACCCTCTGTTCCAAGGTGGCTGG + Intergenic
937193417 2:120127174-120127196 CCCTTAGGTTTTCAGGTGGGAGG + Intronic
937669392 2:124522151-124522173 CCCCTGAGCTCCCAGTTGGCTGG - Intronic
938080564 2:128367865-128367887 CCCCTAGCCTCCCAGATGGGTGG - Intergenic
939085155 2:137709744-137709766 CCCATAGTTTCTCAGGTGGGAGG + Intergenic
941237230 2:162989771-162989793 CCTTTAGGTAACCAGGTGGCTGG - Intergenic
944650683 2:201827329-201827351 CACCTAGCCTCCCAGGTAGCTGG - Intronic
947229846 2:227873793-227873815 CCCTTAGCCTCCCAGGTAGCTGG + Intronic
947405658 2:229773495-229773517 ACCCTAGCCTCCCAAGTGGCTGG + Intronic
948246453 2:236489808-236489830 GCCCCAGCTTCCCAAGTGGCTGG - Intronic
948608672 2:239153006-239153028 TCCCCAGGTCCCAAGGTGGCGGG + Intronic
948793409 2:240390605-240390627 TCTCCAGGTTGCCAGGTGGCTGG - Intergenic
948822014 2:240554813-240554835 CCCCTAGGGCCTCTGGTGGCTGG - Intronic
948981403 2:241496711-241496733 CCACTAGGGTCCCCGTTGGCAGG - Intronic
1168976740 20:1971939-1971961 CCTCTGGGGTCCCAGGTGGCAGG - Intergenic
1169063167 20:2676095-2676117 CCCCTAGCCTCCCAAGTAGCTGG - Intergenic
1171965307 20:31525302-31525324 GCCCTAGTGTCCCAGGTGGAAGG - Intronic
1175021319 20:55852966-55852988 ACCCTAGCTTCCCAAGTAGCTGG + Intergenic
1175385665 20:58593401-58593423 TGCCAAGCTTCCCAGGTGGCAGG - Intergenic
1178858189 21:36267567-36267589 TCCTTAGGCTCCCAGGTAGCTGG - Intronic
1179535660 21:42049827-42049849 CTCCTTGGTCCCCAGGAGGCAGG - Intergenic
1179840938 21:44072885-44072907 CCGCCTGGTTCCCAGGTGCCAGG - Intronic
1181354033 22:22287980-22288002 ACCTTAGCCTCCCAGGTGGCTGG + Intergenic
1181690422 22:24555863-24555885 GCCCTAGTTTCCCAGCCGGCAGG + Exonic
1183062382 22:35344272-35344294 CCCCCAGCTTTCCGGGTGGCCGG - Intronic
1183081766 22:35461325-35461347 CCCCAAGGTTCCCTGGTCCCTGG - Intergenic
1183300266 22:37055536-37055558 CCCCTAGGCTCCCAGAAGGCAGG - Intronic
1183651275 22:39155252-39155274 CTCCCAGGTTCCCAAGTAGCTGG + Intergenic
1183885517 22:40878089-40878111 GCCCCAGGTTCCCAAGTAGCTGG - Intronic
1183931257 22:41237445-41237467 TCCCCAGGTCCCCAGGTGCCAGG + Exonic
1184152307 22:42646244-42646266 CTCCTGGGCCCCCAGGTGGCTGG - Intronic
1184679409 22:46062046-46062068 CCCCCAGGTCCGCAGCTGGCCGG + Intronic
1184693621 22:46128324-46128346 CCCCTGGGGTCCCAGCTGGGGGG - Intergenic
1184724831 22:46337772-46337794 CCCGCAGGTTACCAGGTGACAGG + Exonic
952964658 3:38613671-38613693 TGCCTTGGCTCCCAGGTGGCTGG + Intronic
954572533 3:51654160-51654182 CCCCTAGCTACCCAAGTAGCTGG + Intronic
956828561 3:73022009-73022031 GCCTTAGGTTCCCAAGTAGCTGG + Intronic
959608154 3:108264518-108264540 TCACTATGTTCTCAGGTGGCAGG - Intergenic
959739069 3:109695220-109695242 CCCATAGGTCCCCCGATGGCAGG + Intergenic
962438654 3:135391539-135391561 CCCCCAGGTTCACAGGTTGCTGG + Intergenic
963742407 3:149093603-149093625 TCCCTAGCCTCCCAAGTGGCTGG - Intergenic
964846425 3:161049161-161049183 ACCCCAGCTTCCCAGGTAGCTGG - Intronic
966401885 3:179555897-179555919 CACCTAGTTTCCCTGGTGCCAGG + Intergenic
966526408 3:180924071-180924093 CCCTCAGGCTCCCAGGTAGCTGG + Intronic
966684899 3:182682964-182682986 CCCCCAGGTTCCCAGGAGCTCGG - Intergenic
966814749 3:183880928-183880950 CCCTTAGCCTCCCACGTGGCTGG + Intronic
967065589 3:185912244-185912266 GCCTTAGCTTCCCAGGTAGCTGG - Intergenic
968129559 3:196184919-196184941 ATCCTGGCTTCCCAGGTGGCTGG - Intergenic
972228096 4:37037932-37037954 ACCCTAGGTTGCCAGGTACCAGG + Intergenic
972387130 4:38578056-38578078 TCCCTAGGTTTCCAGGCTGCTGG - Intergenic
972966252 4:44514010-44514032 CCCCCAGGTTCTCAGGTGTTTGG + Intergenic
973543061 4:51953688-51953710 CCCCCAGGGCTCCAGGTGGCTGG + Intergenic
973812144 4:54581744-54581766 GCCTTAGCTTCCCAGGTAGCTGG - Intergenic
974060938 4:57034918-57034940 CCCTTAGTTTCCCAAGTAGCTGG + Intronic
977124566 4:93149229-93149251 GTCCTAGGTTCCCTTGTGGCTGG - Intronic
977547400 4:98400036-98400058 ACCCCAGCTTCCCAGGTAGCTGG - Intronic
980851379 4:138387294-138387316 CCAACAAGTTCCCAGGTGGCTGG + Intergenic
982076225 4:151739714-151739736 CCCCTAGGTTTCCATGTGACAGG + Intronic
985160263 4:187036679-187036701 ACCCTAGCCTCCCAGGTAGCTGG + Intergenic
986364333 5:7015901-7015923 CTCCTAGGTACCAAGGAGGCTGG - Intergenic
988180219 5:27781768-27781790 CCCCTAGTTTTCCAAGTGGAAGG - Intergenic
989581210 5:43034734-43034756 CCCCTAGGTTTGCTGGTTGCAGG + Intergenic
992557556 5:77917854-77917876 TCCCTTCTTTCCCAGGTGGCAGG + Intergenic
992763972 5:79978018-79978040 TCCTTAGGATCCCAGTTGGCCGG - Intronic
992903374 5:81321139-81321161 CCCCCAGCTTCCCAAGTAGCTGG - Intergenic
993009695 5:82465943-82465965 GCCCCAGCTTCCCAGGTAGCTGG + Intergenic
996061726 5:119039991-119040013 CCCTCAGCTTCCCAGGTAGCTGG - Intronic
996363869 5:122679384-122679406 GCCTTAGCCTCCCAGGTGGCTGG + Intergenic
996666407 5:126065283-126065305 AACTTAGGTTCCGAGGTGGCTGG + Intergenic
996970238 5:129358263-129358285 ACCTTACGTTCCAAGGTGGCTGG - Intergenic
997085282 5:130789925-130789947 GCCCCAGCTTCCCAGATGGCTGG - Intergenic
999456008 5:151716893-151716915 GCCTCAGCTTCCCAGGTGGCTGG - Intergenic
999577636 5:152997506-152997528 GCCTTAGTCTCCCAGGTGGCTGG + Intergenic
1002106280 5:176880830-176880852 CCCCTATGTGCCCCGGCGGCCGG - Exonic
1005687948 6:28273143-28273165 CCCTTAGCTTCCCAAGTAGCTGG - Intronic
1006741769 6:36313760-36313782 CCCCTAGTTTCCCAGGCCTCAGG - Intergenic
1014620548 6:123661546-123661568 GCCTTAGCCTCCCAGGTGGCTGG + Intergenic
1016355852 6:143217621-143217643 CCCTTAGCCTCCCAGGTAGCTGG + Intronic
1016550119 6:145270063-145270085 CTCCTAGGTTCCCAGGAGATAGG - Intergenic
1016795154 6:148110039-148110061 CCCCTACTTTCCCAGCTGACTGG + Intergenic
1017052121 6:150403040-150403062 ACCTTAGCTTCCCAGGTAGCTGG + Exonic
1017090548 6:150755088-150755110 GCCCTAGTTTCCCAAGTAGCTGG + Intronic
1018199659 6:161383448-161383470 CCCCTAGGATCCCTTGTGTCTGG + Intronic
1018544359 6:164919051-164919073 CCCCTGTGTTCCCAGGTCCCAGG - Intergenic
1023870367 7:44260165-44260187 CTCCTAGGTTCGCAGGTCCCTGG + Intronic
1024714163 7:52055616-52055638 CCCTCAGGTTCCCATGTAGCAGG - Intergenic
1025734521 7:64135278-64135300 CCCCCAGGCTCCCAGCTGCCTGG - Intronic
1026160363 7:67863212-67863234 CCCCCAGGCTCCCAGATGCCTGG - Intergenic
1029481031 7:100813054-100813076 CCGCTTCGTTCCCAGGTGCCCGG + Intronic
1030605249 7:111633187-111633209 CCCCTGGGTCCCCAGGTGGAAGG + Intergenic
1030655983 7:112168588-112168610 ACCTCAGGTTCCCAGGTGGCTGG - Intronic
1032544563 7:132730889-132730911 ACCCTAGCCTCCCAGGTAGCTGG - Intergenic
1032633340 7:133678723-133678745 GCCTCAGGCTCCCAGGTGGCTGG + Intronic
1033375074 7:140752279-140752301 GCCCTAGCCTCCCAGGTAGCTGG + Intronic
1033577703 7:142701955-142701977 CCCTTGGCTTCCCAGGTAGCTGG - Intergenic
1034461942 7:151202885-151202907 ACCCTAGGTGCCCAGGAGGAGGG - Intronic
1034607330 7:152329453-152329475 ACCTTAGCCTCCCAGGTGGCTGG - Intronic
1035183681 7:157109265-157109287 GCCTTAGCTTCCCAGGTGGCTGG - Intergenic
1035260070 7:157655524-157655546 CCATTAAGTTCCCAGGTTGCAGG - Intronic
1035406029 7:158597928-158597950 GCCTTAGCCTCCCAGGTGGCTGG - Intergenic
1035431835 7:158828845-158828867 CACCTAGGTTGGCAGGTCGCAGG + Intronic
1036236151 8:7041448-7041470 ACCCCAGGTTCCCAGGAGGCTGG - Intergenic
1036637425 8:10561241-10561263 CCCTTAGCTTCCCAAGTAGCTGG + Intergenic
1037623021 8:20583707-20583729 CACCTAGGATCCTAGGTGACAGG + Intergenic
1037905772 8:22715326-22715348 ACCCTAGGAGCCCAGCTGGCTGG + Intronic
1038188648 8:25298687-25298709 CTCCTCTGTTCCCAGGTAGCTGG + Intronic
1041632287 8:60101570-60101592 CAACTAGGGTCCAAGGTGGCTGG - Intergenic
1047557326 8:125946543-125946565 ACCCTAGGTTGCCTTGTGGCTGG - Intergenic
1049382008 8:142320835-142320857 CCTCTAGACTCCCATGTGGCAGG + Intronic
1049551690 8:143262971-143262993 CCCTTAGCTTCCCAGGTATCCGG - Intronic
1051316184 9:15835540-15835562 GCCCCAGCTTCCCAGGTAGCTGG + Intronic
1051411523 9:16794428-16794450 CCTCTCTCTTCCCAGGTGGCTGG - Intronic
1052808126 9:33031544-33031566 GCCCCAGCTTCCCAGGTAGCTGG + Intronic
1052812557 9:33074493-33074515 ACCCCAGCTTCCCAGGTAGCTGG - Intronic
1054778124 9:69140959-69140981 GCCTTAGCTTCCCAGGTAGCTGG + Intronic
1055347022 9:75350212-75350234 CCTCCATGTTCCCAGGTGGAGGG + Intergenic
1056663069 9:88558908-88558930 CCCCTCTGATCCCAGGTGGCAGG + Intronic
1059439679 9:114299992-114300014 GCCCTGAGGTCCCAGGTGGCTGG + Intronic
1060057074 9:120423930-120423952 ACTCTTGGTGCCCAGGTGGCTGG - Intronic
1060204489 9:121674502-121674524 CCGCAAGGATCCCAGGTGGCCGG - Intronic
1060234707 9:121854034-121854056 TCCCAAGGTTTCCAGGAGGCAGG + Intronic
1060373363 9:123096681-123096703 GCCCTAGCCTCCCAGGTAGCTGG + Intronic
1061401749 9:130372279-130372301 CCCCTCCCTCCCCAGGTGGCTGG + Intronic
1062078519 9:134605755-134605777 CCCCTAGGTCCCCAGAGAGCAGG + Intergenic
1185926378 X:4151704-4151726 GCCTCAGGTTCCCAAGTGGCTGG + Intergenic
1189209062 X:39267388-39267410 TCCCTAGCATCCCAGGAGGCTGG - Intergenic
1189266351 X:39719753-39719775 CCACTAGGTTCCAGGGTGGTTGG - Intergenic
1190734828 X:53249354-53249376 CCCCTAGATTTCCAGGGAGCTGG + Intronic
1197692115 X:129513407-129513429 CCCCCAGCCTCCCAGGTAGCTGG - Intronic
1198873970 X:141203502-141203524 CTCATAGGCTCACAGGTGGCAGG - Intergenic
1199699525 X:150365154-150365176 CCCTTTGTTTCCCAGGAGGCTGG + Intronic
1200158648 X:153992675-153992697 CTCCTAGCTACCCAGGAGGCTGG - Intergenic
1200862035 Y:8003363-8003385 GCCTTAGCTTCCCAGGTAGCTGG + Intergenic