ID: 1139968460

View in Genome Browser
Species Human (GRCh38)
Location 16:70758713-70758735
Sequence ATCCTGCTGGGTCCCTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139968460_1139968467 19 Left 1139968460 16:70758713-70758735 CCCAAACAGGGACCCAGCAGGAT 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1139968467 16:70758755-70758777 CATTCTGCACTGTGGAAATCAGG 0: 1
1: 0
2: 1
3: 13
4: 188
1139968460_1139968468 20 Left 1139968460 16:70758713-70758735 CCCAAACAGGGACCCAGCAGGAT 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1139968468 16:70758756-70758778 ATTCTGCACTGTGGAAATCAGGG 0: 1
1: 0
2: 0
3: 10
4: 275
1139968460_1139968464 11 Left 1139968460 16:70758713-70758735 CCCAAACAGGGACCCAGCAGGAT 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1139968464 16:70758747-70758769 GCACCCTGCATTCTGCACTGTGG 0: 1
1: 0
2: 2
3: 18
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139968460 Original CRISPR ATCCTGCTGGGTCCCTGTTT GGG (reversed) Intronic
900192674 1:1358148-1358170 CTCTTGCTGGGGCTCTGTTTAGG - Intronic
900525110 1:3124745-3124767 ATCCTGCTGGGGCCCACCTTAGG - Intronic
902551575 1:17222766-17222788 ATCTTGCTGGGTCCGTGTGTGGG - Intronic
902632252 1:17711916-17711938 CCACTGCTCGGTCCCTGTTTTGG - Intergenic
903327484 1:22577694-22577716 GTGCTGCTGGGTTCCTGTGTCGG + Intronic
909221971 1:72976257-72976279 ATACTGCTGGTTCCAGGTTTTGG + Intergenic
913340463 1:117753149-117753171 ATCCTGCTGGGCCCTGGTCTTGG - Intergenic
915196645 1:154194606-154194628 ATCCGGCTGGATCCCTGTGAGGG - Intronic
917983611 1:180292209-180292231 ATCCTGCTGGGATTCTGATTGGG + Intronic
918209726 1:182340073-182340095 CACCTTCTGGGTCCCTGTTATGG - Intergenic
918825425 1:189317113-189317135 CTCCTGCTGGGCCCCTGAGTAGG - Intergenic
919981344 1:202644273-202644295 CTTCTGCTGGGTTCCTGTCTGGG - Intronic
920690345 1:208141910-208141932 TTCCTTCTGGGGCCCTGTCTTGG + Intronic
921392986 1:214635678-214635700 AGCCTGCTGGGTCCCAGGATTGG + Intronic
1064667346 10:17668871-17668893 ATCTTGTTGGCTCCCAGTTTTGG + Intronic
1066455508 10:35568504-35568526 ATCCCCCTGGGTCCCTCTTTCGG + Intronic
1068349629 10:55825600-55825622 ACCCTGCTGGGTATCTGCTTGGG + Intergenic
1072658662 10:97348482-97348504 ATCATGCTGGGTCCTGGTTTGGG - Intergenic
1076757505 10:132580171-132580193 AGCCTGCTGGGTCCCTGATATGG + Intronic
1079295459 11:19229546-19229568 CTCCAGCTGGCTCCCTGGTTCGG + Exonic
1079314498 11:19396327-19396349 ATCATGTTGGGCCCCTGCTTGGG - Intronic
1082210739 11:49498366-49498388 ATCCTGAGGGGGCCCTATTTTGG + Intergenic
1085094847 11:73751876-73751898 ATCTTGCTGAGTTCCTTTTTGGG - Intronic
1092943183 12:13429326-13429348 ATCCTGCTGGGTCTCAGTAGGGG + Intergenic
1094485878 12:30926064-30926086 TTCCTGCTGAGTCCCTGTGAAGG - Intergenic
1094582704 12:31749110-31749132 CTCCTGCTGGCTCAGTGTTTTGG - Intergenic
1096204762 12:49711937-49711959 TTCCTGCTGCGTCCCTGATCTGG + Intronic
1097040356 12:56152611-56152633 ACCCTGCGGGGTCCGTGTCTGGG - Exonic
1101627730 12:106461989-106462011 CTCCTCCTGGATCCCTGTCTTGG + Intronic
1103723980 12:122988912-122988934 ACCCTTCGGGGTCCCTGTCTGGG - Intronic
1103964311 12:124628687-124628709 ATCTTGGTGGCTCCCAGTTTAGG + Intergenic
1106565790 13:30883534-30883556 ATCCTGCTGCCTCCCTGGGTGGG - Intergenic
1113924489 13:113933538-113933560 ATCCTGCTGGGATTCTGATTGGG + Intergenic
1114212313 14:20625882-20625904 ATCCTGCCTAGACCCTGTTTTGG + Intergenic
1114423494 14:22603698-22603720 ATCCTCCTGGGGCACAGTTTGGG + Exonic
1115570903 14:34665357-34665379 ATTGTGCTGGGTCCCTCTTAGGG + Intergenic
1116858464 14:49974395-49974417 AAGCTGGTGGGTTCCTGTTTGGG + Intergenic
1120753961 14:88224551-88224573 ATCCTGAGGTGACCCTGTTTTGG - Intronic
1120869451 14:89323873-89323895 ATGCTGCTGGGTCCAAGTTTTGG + Intronic
1124079032 15:26474346-26474368 ACCCTGATGGGTCCCTGTGCTGG - Intergenic
1128232170 15:66043023-66043045 CTCTGGCTGGGTCCCTGATTCGG - Intronic
1129239499 15:74243084-74243106 AAGCTGCTGAGTCCCTGCTTGGG + Intronic
1132585213 16:703211-703233 ATCCTGCAGGGTCCCTGCCACGG + Intronic
1133634625 16:7653704-7653726 GTCCTGCTGGGACCCTGTGCAGG + Intronic
1133849846 16:9492536-9492558 ACCCTGCTGTGTCACTGTATTGG - Intergenic
1133906229 16:10025271-10025293 ACCCTGCTGCGTCCCTGATCTGG - Intronic
1134998300 16:18756348-18756370 ATCCTGTTGGTTCCCTTTCTCGG + Intergenic
1136164939 16:28447338-28447360 ATTTTGCTGAGTCACTGTTTGGG + Intergenic
1136198027 16:28667643-28667665 ATTTTGCTGAGTCACTGTTTGGG - Intergenic
1136214373 16:28781819-28781841 ATTTTGCTGAGTCACTGTTTGGG - Intergenic
1136259095 16:29061663-29061685 ATTTTGCTGAGTCACTGTTTGGG - Intergenic
1138335186 16:56247231-56247253 ACCCTGCTGTCTCCCTGTCTTGG + Intronic
1138437717 16:57014791-57014813 GGCCTGCTGGCTCCCTGATTGGG - Intronic
1139968460 16:70758713-70758735 ATCCTGCTGGGTCCCTGTTTGGG - Intronic
1140420959 16:74818279-74818301 ACCCTGCTCCGTCCCTATTTTGG + Intergenic
1144326837 17:14190555-14190577 ATTCTGTTGGGTCACTCTTTGGG + Intronic
1144475717 17:15587418-15587440 ATTCTGTTGGGTCACTCTTTGGG + Intronic
1144476762 17:15595460-15595482 CTCCTGGTGGGTCTGTGTTTGGG + Intronic
1144921480 17:18767889-18767911 CTCCTGGTGGGTCTGTGTTTGGG - Intronic
1145286098 17:21506845-21506867 CTCCTGCTGGGTCCCAGGGTGGG - Intergenic
1145391505 17:22459446-22459468 CTCCTGCTGGGTCCCAGGGTGGG + Intergenic
1149733431 17:58969657-58969679 ATCCTGCTGAGGCCCTGTGCAGG + Exonic
1152514160 17:80812574-80812596 CTGCTGCTGGGTCCCTTTTTTGG + Intronic
1152813257 17:82392141-82392163 GTCCTGCTGGGTCCCTTTCCTGG + Exonic
1156837652 18:41574573-41574595 CTCCTGCTGGGTCTTAGTTTTGG - Intergenic
1158478641 18:57802559-57802581 GTCCTGCTGGGGCGCTCTTTGGG - Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1164446897 19:28325489-28325511 ATTTTGCTAGGTCCCTGTTGAGG - Intergenic
1164769182 19:30795227-30795249 AGCCTGCAGGGTCCCCTTTTTGG + Intergenic
1165322758 19:35096446-35096468 ATCCTGCTGTGTCCCAGCTCTGG - Intergenic
1165937091 19:39395941-39395963 CTTCTCCTAGGTCCCTGTTTCGG - Intronic
1166923130 19:46245539-46245561 ATCCTGCTGTCTCCATGTTGCGG + Intergenic
1167239281 19:48333704-48333726 ATCCTGCGCGCTCCCTGTGTGGG - Intronic
1167474727 19:49693182-49693204 CTCCTGCTCTGTCCCTGTTCTGG + Intronic
925350963 2:3200539-3200561 TTCCTGCTTGGTCCGTGTGTGGG - Intronic
926567581 2:14493837-14493859 ATCCTTCTGGATCCATTTTTGGG - Intergenic
927554949 2:24024744-24024766 CTCCTTCTGTGTCCCTGTCTTGG + Intronic
928129678 2:28640766-28640788 AGGCTGCTGGGTCCCTGCTGTGG + Intronic
933987776 2:87606916-87606938 TTCCTACTGGGTCTCTGTTGGGG - Intergenic
934525782 2:95050741-95050763 ATCCTGAGGGGGCCCTTTTTAGG - Intronic
936306065 2:111343892-111343914 TTCCTACTGGGTCTCTGTTGGGG + Intergenic
938104450 2:128520547-128520569 ATCCTGTTGGGTGCCTGGCTGGG - Intergenic
940805960 2:158186764-158186786 ATCTTGCTAGGTCCCAGGTTAGG + Intronic
941028243 2:160482699-160482721 ATCCTCCTAGCTCCCTTTTTTGG - Intronic
946155324 2:217803258-217803280 ATTCTGCAGGGTCCCTGTGTTGG - Exonic
947478920 2:230479569-230479591 TTCCTTCAGGGTACCTGTTTTGG + Intronic
948971235 2:241428825-241428847 ATCCTGATGGGTGCCTGTTCTGG - Intronic
1169414137 20:5401429-5401451 TTCCTGCTGGGACCCTGATCGGG + Intergenic
1170127834 20:12985648-12985670 ATGCTGCTGGGTCCTTGTAACGG + Intergenic
1171408595 20:24930630-24930652 ACACTGCTGCGTCACTGTTTTGG - Intergenic
1172220044 20:33267727-33267749 ATTCTGCTTGGTCACTGTTATGG - Intergenic
1172328802 20:34059367-34059389 AGCCTGCTGGCTTCCTGCTTGGG + Intronic
1173808491 20:45941539-45941561 CTCCTCCTGGGTCCCGGTTCAGG + Intronic
1177630358 21:23719204-23719226 GTCATGCTGGGGCCGTGTTTGGG - Intergenic
1182781279 22:32869977-32869999 ATCCTCCTGGGGCCCTGTGATGG - Intronic
1183206969 22:36426344-36426366 GGCCAGCTGGGTCCCTGTGTGGG - Intergenic
1183609684 22:38891241-38891263 ATTCTGCTGGGTCCTTGTGAGGG + Intergenic
949101040 3:145607-145629 ATCATGCTGGCTCCCTGCTGAGG + Intergenic
952734815 3:36678701-36678723 ATCCTGGTGGGGACCTCTTTGGG - Intergenic
953715083 3:45310574-45310596 ATCCTACTGAGTTCCTATTTTGG + Intergenic
960490564 3:118312574-118312596 TTCCTTCTGGGTCCCTGTGTAGG - Intergenic
968551188 4:1224057-1224079 ATCCTGCTGGGGCCGGGGTTCGG - Intronic
971068823 4:23066949-23066971 ATCCTGCTGGGCCATGGTTTTGG + Intergenic
972233222 4:37099409-37099431 ATGCAGCTGGATCCCTTTTTGGG - Intergenic
978082101 4:104606055-104606077 CTCCTGGTGGGTCCCTGGATAGG + Intergenic
980796214 4:137686924-137686946 ATCCTGATAGGTCACTCTTTAGG - Intergenic
981573354 4:146176708-146176730 ATCATTGTGGGTCCCAGTTTAGG + Intronic
985006112 4:185536502-185536524 GTCCTGCTGACTGCCTGTTTGGG + Intergenic
985970427 5:3373840-3373862 ATCCTGAAGGGACCCTGTCTTGG - Intergenic
988414437 5:30928325-30928347 ATCCTGCCGGCACCCTGATTTGG - Intergenic
989239715 5:39189852-39189874 AAACTGCTGAGTCCTTGTTTAGG + Intronic
992260621 5:74966677-74966699 ATCCTGAAGGGTACCTGGTTCGG - Intergenic
992476542 5:77107944-77107966 ATGCTGCTGGGTCAGTGTGTGGG - Intergenic
992883846 5:81138135-81138157 ATCTTACTGGGTCTCTGTTAGGG + Intronic
997904330 5:137800123-137800145 ATCCTGCTGGGTCACTGGCTGGG - Intergenic
997969877 5:138392265-138392287 ATCCTGCTGGGGCTATATTTGGG + Intronic
998265447 5:140664673-140664695 GTCCTGCTGTGACCCCGTTTGGG - Exonic
998846562 5:146316012-146316034 TACCTGCTGGGCCCCTGTGTAGG + Intronic
999767184 5:154750109-154750131 AGCCTGCTGTGTCTCTCTTTAGG + Intronic
1003656098 6:8010152-8010174 ATCCAGCTCAGTCCCTGTTATGG - Intronic
1012067208 6:94563267-94563289 ATTCTTCTTGGTCCCTGTTTGGG - Intergenic
1012583185 6:100892924-100892946 CTCCTGCTGGGTCCATGCCTGGG + Intergenic
1017516771 6:155163319-155163341 CTTCTGCTGAGTCCCTGTGTTGG + Intronic
1017536607 6:155353385-155353407 ATCCTGAAGGGACCCTGTCTTGG + Intergenic
1018151054 6:160940086-160940108 CTACTGCTGGGTCCCTGAGTGGG + Intergenic
1022426995 7:30278463-30278485 ATCCTGCTACTTCCCTGTTTGGG + Intergenic
1022704346 7:32788525-32788547 ATCCTGCTGTGACCCATTTTGGG - Intergenic
1022908524 7:34878267-34878289 ATCCTGCTGTGACCCATTTTGGG - Exonic
1022945986 7:35284083-35284105 ATCCCGCTGCCTCTCTGTTTGGG - Intergenic
1024234240 7:47385802-47385824 ATGCTGCTGGGCCCCTGACTAGG - Intronic
1025003884 7:55340712-55340734 GCCCTGCTGGGACCCTGGTTAGG - Intergenic
1028499715 7:91505930-91505952 ATCCTGCTGGGACTTTGATTGGG - Intergenic
1032098755 7:128955220-128955242 ATCCTGAGGAGTTCCTGTTTGGG - Exonic
1034751341 7:153571690-153571712 ATCCAGCAGGGACCCTGTATGGG - Intergenic
1035214191 7:157352528-157352550 TTCCTGCTGGCTCCCTGGTGAGG + Intronic
1036435497 8:8729414-8729436 ACTCTACTGGGTCCCTTTTTTGG + Intergenic
1037596340 8:20357504-20357526 ATACCAGTGGGTCCCTGTTTGGG + Intergenic
1042143637 8:65704888-65704910 CTCCTGCTGGGTCACAATTTTGG - Exonic
1043207491 8:77464747-77464769 ATCCAGCTGAATCCCTGTTTTGG + Intergenic
1045096305 8:98801036-98801058 AGCCAGCTGGGTTCCTGTGTTGG + Intronic
1045639257 8:104229540-104229562 AGCCTTCTGGCTCCCAGTTTAGG - Intronic
1047428376 8:124767321-124767343 GTCCTGCTGGGTCCCTGGAAGGG + Intergenic
1047573115 8:126122654-126122676 CTCTTGCTGGGTCACTGATTTGG + Intergenic
1048406906 8:134132506-134132528 GTCCTGCTGTGTCCCTCTGTTGG + Intergenic
1049381777 8:142319796-142319818 AGCCTGCTGGGTGCCTGTTCTGG - Intronic
1049824674 8:144661137-144661159 AAGCTGCTGGGACCCTGTGTAGG - Intergenic
1051496342 9:17727738-17727760 ATTCTGCTGGGTCCCTGTGAGGG - Intronic
1052362199 9:27573391-27573413 ATCCTGGCGGGTGGCTGTTTGGG - Intronic
1053175855 9:35923293-35923315 ATTCTCCTGGGTCCCAATTTTGG + Intergenic
1057895889 9:98908364-98908386 ATGCTGCTGGTTCCCTGCTAGGG + Intergenic
1060836413 9:126758356-126758378 ATCCTTCTGGGTCCTGGTTGTGG - Intergenic
1061998985 9:134206578-134206600 AGCCAGCTGTGTCCCTGCTTTGG - Intergenic
1062203878 9:135324749-135324771 ATCCTGCTGGGACCCTGGGCTGG + Intergenic
1188338965 X:28975633-28975655 TTACTGCTGGATCCCTGGTTAGG - Intronic
1188895247 X:35659358-35659380 ATCCTGAGGGGTCCCAGTCTCGG - Intergenic
1190321254 X:49180651-49180673 CTCCTTCTTTGTCCCTGTTTTGG + Intronic
1192299631 X:69886394-69886416 CTCCTGGTGGGTCCCTGGGTGGG - Intronic
1192707088 X:73537852-73537874 CTCCTGCTGGGTCCCTGAGTGGG - Intergenic
1193811471 X:86056556-86056578 TTCCTGCTGGGACCCTGATAGGG - Intergenic
1198082224 X:133250896-133250918 ATCCTGCTGTGGCCCTTTTCTGG + Intergenic
1200948350 Y:8867883-8867905 ACACTGCTGTGTCACTGTTTTGG - Intergenic