ID: 1139968679

View in Genome Browser
Species Human (GRCh38)
Location 16:70760308-70760330
Sequence TATCCTAGAAAGGAAGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139968677_1139968679 -2 Left 1139968677 16:70760287-70760309 CCTGAGAGGGCACTTTCTAGATA 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1139968679 16:70760308-70760330 TATCCTAGAAAGGAAGTTTCAGG 0: 1
1: 0
2: 1
3: 21
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139968679 Original CRISPR TATCCTAGAAAGGAAGTTTC AGG Intronic
901173603 1:7282547-7282569 AAGCCTAGAAAAGGAGTTTCAGG - Intronic
904030449 1:27530149-27530171 GATCCTAGAAAGGAATTGCCTGG - Intergenic
907736516 1:57118012-57118034 TATCCTTGAAAGTAAGTCACTGG - Intronic
910141822 1:84034510-84034532 TATCTGTGAAAGGATGTTTCTGG + Intergenic
911442823 1:97950012-97950034 CATTCTAGAAATGAAGATTCAGG + Intergenic
912127456 1:106556231-106556253 GATTCTTGAAAGGAATTTTCAGG - Intergenic
912176399 1:107163151-107163173 CCTTCTTGAAAGGAAGTTTCTGG + Intronic
912306344 1:108571420-108571442 AATCCTAGAACAGAGGTTTCAGG + Intronic
913353255 1:117886680-117886702 TATTCTTGGAATGAAGTTTCTGG - Intronic
913409043 1:118530681-118530703 TATTTTAGAAAGGATGTTTCAGG - Intergenic
914791312 1:150879696-150879718 TAAACCAGACAGGAAGTTTCTGG - Intergenic
915721143 1:157986509-157986531 TTTCCTAGAAATGGAGATTCAGG - Intergenic
917253000 1:173082669-173082691 AAACCTAGAAAATAAGTTTCTGG + Intergenic
917562778 1:176176914-176176936 TTTCCTAGAAGGCAAGTTGCAGG + Intronic
919355132 1:196512461-196512483 TAACATGGAAAGGAGGTTTCAGG - Intronic
920752090 1:208688237-208688259 TATTTTAGAAAGCAAGTCTCTGG + Intergenic
921344430 1:214167621-214167643 TTTTCCAGAAAGGAAATTTCAGG + Intergenic
1063657537 10:8007048-8007070 ATCCCTAGAAATGAAGTTTCTGG - Intronic
1064261757 10:13791857-13791879 TCTCCTAGAAAGAAAACTTCAGG - Intronic
1064442515 10:15366418-15366440 TATTTTAGAAATTAAGTTTCAGG - Intronic
1064726109 10:18281668-18281690 TTTCCTGGAATGGATGTTTCTGG + Intronic
1067662253 10:48245020-48245042 TCTGCTAGAAAGCAAATTTCTGG - Intronic
1067718683 10:48709867-48709889 CATGCTGGAAAGGAAGTTTCTGG + Exonic
1068346945 10:55793385-55793407 TATCCAAGAAATGAAGTATATGG + Intergenic
1070106782 10:73440569-73440591 TAGAATAGAAAGGAAGTTACTGG - Intronic
1070997040 10:80793893-80793915 TAGCCTAGCAAAGAAGTTTGTGG + Intergenic
1071130556 10:82388051-82388073 AATCTTAGAAATGAAATTTCTGG - Intronic
1072176836 10:92933412-92933434 TATGCTATAAAGCAAGTATCAGG + Intronic
1073010938 10:100359069-100359091 TATCATAGGAATGGAGTTTCTGG + Intronic
1073221288 10:101876349-101876371 TTTCCAAGAAAAGAAATTTCAGG - Intronic
1074287630 10:112113209-112113231 TATCCCCAAATGGAAGTTTCTGG - Intergenic
1076827678 10:132977639-132977661 TGTGCTTGCAAGGAAGTTTCAGG + Intergenic
1078754458 11:14195888-14195910 CATCCTAGAAGTGAAATTTCTGG + Intronic
1081658397 11:44873141-44873163 TATCTTAGAATGGAAATTTTTGG - Intronic
1087218173 11:95517394-95517416 TTCCCTAGAAAGGAGGTTTTTGG - Intergenic
1088832815 11:113551998-113552020 CATCCTAGAATTGAAATTTCTGG + Intergenic
1089133842 11:116233758-116233780 TGTCCTGGGAAAGAAGTTTCTGG - Intergenic
1089818001 11:121193695-121193717 CATCCTGGAATGGAAGTTGCTGG + Intergenic
1090671025 11:128945405-128945427 TCTCCTAGAATGGAAGTTCCTGG - Intergenic
1091481339 12:834894-834916 AATACTAAAAAGGAAGATTCTGG - Intronic
1093560946 12:20539069-20539091 CATTTTAGAAAGTAAGTTTCAGG - Intronic
1094392588 12:29967982-29968004 TATTCTATGAAGGAGGTTTCTGG + Intergenic
1096445610 12:51688554-51688576 TATATTAGAAAGGAGGTTTTTGG - Intronic
1096732256 12:53623625-53623647 TCTCCTTGCAAGGAAGTTTTAGG - Intronic
1096930327 12:55200779-55200801 TATCCTAGACAGAGAGCTTCTGG - Intergenic
1099177853 12:79442521-79442543 TATCCTAGTAATGCAGTCTCTGG + Intronic
1100589263 12:96010192-96010214 TACACTAATAAGGAAGTTTCAGG - Intronic
1100669850 12:96799899-96799921 TATCATAAAATGGAAGTTTCAGG - Intronic
1100851586 12:98717937-98717959 ATTCCTAGAGAGGAATTTTCTGG + Intronic
1101496339 12:105258054-105258076 CATCCCAGAAAGCAAGATTCAGG - Intronic
1106759596 13:32855703-32855725 TATACTAGTCTGGAAGTTTCAGG - Intergenic
1107387448 13:39927533-39927555 TACACTAGAAAGGGAGTTACTGG - Intergenic
1107474605 13:40723266-40723288 TATCGTTGAAAGCAAGTCTCAGG + Intergenic
1108496033 13:51026232-51026254 GAGCCAAGAAAGCAAGTTTCTGG - Intergenic
1110430010 13:75412758-75412780 TAACATATAATGGAAGTTTCAGG + Intronic
1113962086 13:114131973-114131995 TTCCCCGGAAAGGAAGTTTCTGG + Intronic
1114250688 14:20957781-20957803 TATCCCAGTATGGAAGTTTTGGG - Intergenic
1115109366 14:29802965-29802987 TATTTTAAAAATGAAGTTTCTGG + Intronic
1115806097 14:37053641-37053663 GAAGCTAGAAGGGAAGTTTCTGG - Intronic
1117507214 14:56415734-56415756 TATGCTTGTAAGGATGTTTCTGG - Intergenic
1118675636 14:68181664-68181686 AATACTAGAAAGGAAGTTACGGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120150330 14:81025608-81025630 AATCCTAGAACCAAAGTTTCTGG - Intronic
1121075916 14:91068196-91068218 TAAGCTAGAAAGGTAGTATCTGG - Intronic
1121681189 14:95793941-95793963 CTACTTAGAAAGGAAGTTTCTGG + Intergenic
1129191578 15:73940887-73940909 TAGCCTAGATAGGAAGGGTCAGG + Intronic
1130327723 15:82895170-82895192 GGACCTAGAAGGGAAGTTTCAGG - Intronic
1130354111 15:83114418-83114440 TCTCCAAGAAAGGAAGTGTTCGG - Intronic
1131331920 15:91508554-91508576 ATTCCTAGAAATGAAATTTCTGG - Intergenic
1133295938 16:4752345-4752367 AGTCCTGGAAAGGGAGTTTCAGG + Exonic
1133463192 16:6005283-6005305 TATCCAAGAAATGGAGTTCCTGG - Intergenic
1135647795 16:24178435-24178457 TATTATAGAAAAGAAGTTTCAGG - Intronic
1139968679 16:70760308-70760330 TATCCTAGAAAGGAAGTTTCAGG + Intronic
1145758830 17:27413539-27413561 TATAGTAGAAAGGAGGTTCCAGG - Intergenic
1146556877 17:33832727-33832749 TATTCTAGAAATGGAGTTGCTGG - Intronic
1146861255 17:36301133-36301155 TATCCCAGACAGGAACTTTCTGG - Intronic
1147091586 17:38105237-38105259 TATCCCAGACAGGAACTTTCTGG - Intergenic
1147105626 17:38215268-38215290 TATCCCAGACAGGAACTTTCTGG + Intergenic
1147835715 17:43330119-43330141 TATTCAAGGAAGGAAGTTTGAGG - Intergenic
1148423877 17:47573234-47573256 TACCCCAGACAGGAACTTTCTGG - Intronic
1148496599 17:48056671-48056693 TCTTCTCTAAAGGAAGTTTCTGG - Intronic
1153554205 18:6293956-6293978 TTTCCTATAAAGGATGTTACTGG + Intronic
1153827675 18:8891410-8891432 GGTCCTAGATGGGAAGTTTCTGG - Intergenic
1154941983 18:21123205-21123227 TATCATATAAAGAAAGTTCCAGG + Intergenic
1155319039 18:24600301-24600323 TAGTTTATAAAGGAAGTTTCAGG + Intergenic
1157441328 18:47714053-47714075 TACCCTAGACAGGGAGTCTCAGG + Intergenic
1159977653 18:74734877-74734899 TATGCTAGAAAGAAAATTTATGG - Intronic
1160215566 18:76926508-76926530 TATGGTAGAAAGTAGGTTTCTGG + Intronic
1160601937 18:80020371-80020393 TATCCTCTAAAGGAAGTCTGTGG - Intronic
1161919583 19:7256012-7256034 TACCCTAGAGAGTATGTTTCTGG - Intronic
1162454548 19:10775530-10775552 GATCCTAGAAGGGGAGTTACTGG + Intronic
1164187317 19:22881725-22881747 AATCGCAGAAAGGAAGCTTCAGG + Intergenic
1164364297 19:27557898-27557920 TTTCCTAGAAAGAAGCTTTCTGG + Intergenic
1164951656 19:32342410-32342432 TTTCCTAGAAAAGAACTCTCTGG - Intergenic
1168582119 19:57564293-57564315 TATCCTCTAAGGGAAGTCTCTGG - Intergenic
925158396 2:1664121-1664143 TATCCCGGAAAGGAACTTGCTGG - Intronic
925722454 2:6842347-6842369 TATCCTCTAAAGGAAGTCTCTGG - Intronic
926103778 2:10137590-10137612 TATGCTAGAAAGGTAGCTTATGG + Intergenic
926603967 2:14877836-14877858 TATGCTATAAAGGAGCTTTCTGG + Intergenic
926710065 2:15872114-15872136 TGTCCCTGAGAGGAAGTTTCTGG - Intergenic
926998224 2:18762512-18762534 TATCCTATAAAGTTATTTTCAGG - Intergenic
933918987 2:87025722-87025744 TGTCCTAGAATGGCAGTTCCCGG - Intergenic
934004007 2:87744192-87744214 TGTCCTAGAATGGCAGTTCCCGG + Intergenic
937668054 2:124509288-124509310 TATTCTAGGGATGAAGTTTCAGG + Intronic
941304373 2:163843650-163843672 TATCCTAAAAATGGAGTTTGGGG + Intergenic
942049648 2:172127193-172127215 TACCCTAGAAAATAAGTGTCTGG - Intergenic
942241582 2:173967182-173967204 TTCCCTAGAAAGGATATTTCAGG + Intergenic
942835111 2:180286055-180286077 TAACCTAGAAAGCATGATTCTGG + Intergenic
944295590 2:198058445-198058467 AATCATAGAAAAGAATTTTCAGG + Intronic
946891820 2:224284487-224284509 TGTCCAAGAAAGGAAATTTGAGG + Intergenic
948678415 2:239612517-239612539 TGTCCTAGAATGGAAGTCTGAGG + Intergenic
1170142403 20:13138044-13138066 TATTTTAGAAAGGATGTTTAGGG - Intronic
1170457547 20:16547506-16547528 TATTCTGGAAAGGAACTTTCTGG - Intronic
1172188952 20:33050005-33050027 TATCCTAGAAATGAAATTTAAGG - Intergenic
1172508497 20:35482007-35482029 TATTCTTGAAAGATAGTTTCTGG + Intronic
1172794850 20:37529528-37529550 GGTCCTAGAGAGGAGGTTTCAGG + Intergenic
1177592966 21:23196578-23196600 TATTTTAGAAAAGAAGTTTCTGG - Intergenic
1179894340 21:44352855-44352877 CAGCCTAGAAAGGAAGTTTTGGG - Intronic
1181945530 22:26514276-26514298 TTTGCTTGAAAGGAAGTTACAGG + Intergenic
1184387430 22:44184059-44184081 TCTCCTAGAAGGGAGGTTGCAGG - Intronic
949573871 3:5319853-5319875 TGTCCTAGAAGGGAACTGTCTGG + Intergenic
949599824 3:5585644-5585666 TCTCATAGAGAGGAAGTTTCTGG - Intergenic
950205004 3:11072752-11072774 TATCCAAGAAAGTTAGTTTAAGG - Intergenic
951889851 3:27558436-27558458 TTTGCTATAAAGGACGTTTCTGG + Intergenic
952744382 3:36763941-36763963 TCCCCTAGAAAGCAGGTTTCAGG + Intergenic
953709989 3:45261710-45261732 TATCCTTAAAAGGAAGTGTATGG - Intergenic
954962520 3:54578860-54578882 TATATTAGCAAGGCAGTTTCAGG + Intronic
954971666 3:54656524-54656546 TATCCTACAAAGGAAATGGCAGG - Intronic
955038237 3:55289907-55289929 TTTCCTGGAAAGGGAGTTTTTGG - Intergenic
955814647 3:62829029-62829051 TATCCAAGAAAAGAAGTTTCAGG + Intronic
957550628 3:81699130-81699152 TTTCCTAGAAAGCAGGTTTTTGG - Intronic
959861984 3:111226906-111226928 TATCCTAAAAAGGTAATTTGTGG + Intronic
959915538 3:111812891-111812913 GGTCCTAGAAAGGAAGTGTGGGG + Intronic
960604184 3:119488013-119488035 TTTCATATAAAGGAAGTTTAGGG - Intronic
962680300 3:137792469-137792491 TCTTTTAGAAAGAAAGTTTCAGG - Intergenic
962693172 3:137921691-137921713 GACCCTAGAAAGGAATTTCCAGG + Intergenic
966291871 3:178368858-178368880 TATCCATGAAGTGAAGTTTCTGG - Intergenic
969385409 4:6843307-6843329 TAGTCCAGGAAGGAAGTTTCTGG - Intronic
971913320 4:32825121-32825143 TATTCTAAAATGGAAGTTTCTGG - Intergenic
974347654 4:60702528-60702550 TATCATAAAAAGGGAGTTTAAGG - Intergenic
975643041 4:76519225-76519247 TTTCCTAGAAAGGAGGGTGCTGG + Intronic
977422207 4:96816121-96816143 TATCCCAGAGAGGAAATTTGTGG - Intergenic
977440285 4:97057602-97057624 GATGCTAGAAAAGAAATTTCTGG + Intergenic
981587594 4:146321059-146321081 TATCATAAAATGGAAATTTCTGG - Intronic
983699278 4:170571513-170571535 TATTCTAGAATGGCAGATTCAGG + Intergenic
984051036 4:174865571-174865593 TACCCTAAAATGGAAGTATCAGG - Intronic
985232451 4:187835743-187835765 TGTCATAGACTGGAAGTTTCTGG + Intergenic
987422150 5:17733064-17733086 TATCCTAGAAAGGAATATCATGG - Intergenic
989005752 5:36810341-36810363 TTTCCTAGAAAGGAAACTTAGGG - Intergenic
990859465 5:60310742-60310764 TATTCCATAAAGGAAGATTCAGG - Intronic
991439850 5:66635460-66635482 TATCCTAGAAAACATTTTTCTGG - Intronic
994116033 5:96062255-96062277 TCTACTAGACAGGCAGTTTCTGG - Intergenic
994248690 5:97511465-97511487 TATGCTAGAAATGGAATTTCTGG - Intergenic
994643447 5:102439717-102439739 TATCCTAGAAAGGAATTCCTAGG + Intronic
996055859 5:118981684-118981706 TATGTTAGAAAGGCAGATTCGGG - Intronic
996692999 5:126360941-126360963 TAACCTAGAAAGGTAGGTTTGGG + Intronic
997238425 5:132289260-132289282 TATTCTGCCAAGGAAGTTTCTGG - Intronic
999046800 5:148478415-148478437 CATTCTAGGAAGGAAGTTTCAGG + Intronic
1004721300 6:18269793-18269815 TTTCCCAGAATGTAAGTTTCAGG + Intergenic
1004980402 6:21016939-21016961 TATTTTAGAAAGAAAATTTCTGG - Intronic
1005632543 6:27722080-27722102 GCTCGTAGAAAGGAAGTTTAGGG + Intergenic
1005853139 6:29838021-29838043 TATCCTAGTGAGGATGGTTCTGG - Intergenic
1010590224 6:77703676-77703698 TATCCTAAAAAATAAATTTCAGG - Intronic
1010634058 6:78234717-78234739 TATCCAAGAAAAAAAGTCTCTGG - Intergenic
1011125628 6:84004102-84004124 TATCTAAGGAAGGAAGATTCTGG - Intergenic
1011184946 6:84663803-84663825 TACCCAATAAATGAAGTTTCTGG + Intergenic
1012992128 6:105936771-105936793 TATCTGAGAAAATAAGTTTCAGG - Intergenic
1014896299 6:126904097-126904119 GACCCTGGAAAGGGAGTTTCAGG - Intergenic
1016008519 6:139114065-139114087 CAACCTAAAAAGGAAGTTTCTGG + Intergenic
1018127797 6:160698334-160698356 TGTCCTAGAATGGCAGTTCCCGG + Intergenic
1023116518 7:36868268-36868290 TATCCTAGAACTGAGGTTGCAGG - Intronic
1023551796 7:41377694-41377716 TATCCTGGAAACAAAGTTTGAGG + Intergenic
1024141290 7:46465692-46465714 TATCCTCTAAGGGAAGTCTCTGG - Intergenic
1024965756 7:55020484-55020506 CATCCAAGAAAGAAAGTCTCCGG - Intronic
1026871939 7:73858060-73858082 TATCCTAGAAAAGAAAGTCCAGG - Intergenic
1027862273 7:83600269-83600291 TACACTAGAAAGGAAGCATCTGG + Intronic
1029056531 7:97750538-97750560 ATACCTAGAAAGGAAATTTCTGG - Intergenic
1030381563 7:108817145-108817167 AATCCTAGAAAGGAAGGTGGTGG + Intergenic
1031495302 7:122439946-122439968 TTTGCCAGAAAGTAAGTTTCTGG - Intronic
1032999749 7:137491362-137491384 TTTCCTAGAAAGTAAGGTTCTGG - Intronic
1035694272 8:1583166-1583188 TATCCCAAAACGGAAGTGTCAGG - Intronic
1038951517 8:32420331-32420353 AATACGAGAAAGGAAGTTTTTGG - Intronic
1042384314 8:68155041-68155063 TATCCTAGAAAAGAAGACTGTGG - Intronic
1043598434 8:81911936-81911958 GATCCAAGAAAGGAATTATCTGG - Intergenic
1044016031 8:87049776-87049798 TATCCTCTAAAGGGAGTCTCTGG - Intronic
1044436774 8:92173501-92173523 TACCCTAGAAAGGGAATTTAAGG + Intergenic
1044522588 8:93216526-93216548 TATCTAAGGAAGGAAGTGTCTGG + Intergenic
1047130345 8:122012883-122012905 TAACCTAGAAAAGAATATTCTGG - Intergenic
1047557823 8:125951693-125951715 TATTCTACATAAGAAGTTTCTGG + Intergenic
1047664985 8:127081740-127081762 GATCCTAGTAAAGAAGTCTCAGG - Intergenic
1050369611 9:4907358-4907380 GATCCTAGAAATGAAATTTCTGG + Intergenic
1050515389 9:6438171-6438193 TAACACAGAAGGGAAGTTTCAGG + Intronic
1050671354 9:8001074-8001096 AATACAAGAAAGGATGTTTCAGG + Intergenic
1052552091 9:29964928-29964950 TCTCCTAGAAAGGTAGTGTTGGG + Intergenic
1056326854 9:85487106-85487128 CTTTCTAGAAAGGAAGTTCCTGG + Intergenic
1056934492 9:90905504-90905526 TATTCAAGGAAGGAAGTTTGAGG + Intergenic
1057111516 9:92476584-92476606 TATGCTAGGAAGGAGGTTACAGG + Intronic
1057319553 9:93999986-94000008 TATCCTGGTAGGGAAGTTCCAGG + Intergenic
1057910764 9:99018478-99018500 ATTCCTAGAAGAGAAGTTTCTGG - Intronic
1059217876 9:112583167-112583189 AAACCTGGAAAGCAAGTTTCTGG - Intronic
1186479956 X:9889078-9889100 AATCCTCGTAAGGAAGGTTCTGG - Intronic
1187026473 X:15440483-15440505 AATACTAGGAATGAAGTTTCTGG + Intronic
1188717218 X:33475053-33475075 TATACTAGAAAAGATGTTTAAGG - Intergenic
1193139015 X:78005952-78005974 TATCATAGAAAAGAAATTTTGGG - Intronic
1193946737 X:87746520-87746542 TATCCTAGACAGGAAATATTAGG + Intergenic
1195627196 X:107016535-107016557 TATTTTAGAAAGTAAGTTTCAGG - Intergenic
1197881510 X:131171561-131171583 TATCCTGGAAGGGAACTTTGGGG + Intergenic
1200969133 Y:9131429-9131451 TGTCCTCTAAAGGAAGTCTCTGG - Intergenic
1202141695 Y:21731070-21731092 TGTCCTCTAAAGGAAGTCTCTGG + Intergenic
1202145170 Y:21772732-21772754 TGTCCTCTAAAGGAAGTCTCTGG - Intergenic