ID: 1139978724

View in Genome Browser
Species Human (GRCh38)
Location 16:70836087-70836109
Sequence TATTACATGGGGCTGAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139978724 Original CRISPR TATTACATGGGGCTGAAACT AGG Intronic
903927277 1:26839563-26839585 TAGAAGGTGGGGCTGAAACTAGG - Intronic
904823845 1:33262067-33262089 TAGAACCTGGGGCTGGAACTGGG + Intronic
905826296 1:41028249-41028271 AAGTACATGGGCCTGAAGCTGGG - Exonic
905851186 1:41276234-41276256 TAGTACATTGGGCTGGAACCAGG - Intergenic
907500750 1:54878169-54878191 TATTACCTGAGGCTGAAGCCAGG + Intronic
907585731 1:55616092-55616114 TTTTCCATGAGGATGAAACTGGG + Intergenic
908024749 1:59938794-59938816 TATCACATGGGGATAAACCTTGG + Intergenic
913040892 1:115022135-115022157 TATATGATGGGGTTGAAACTAGG - Intergenic
914355293 1:146879443-146879465 TATTACATGGGGCTGAAACTAGG - Intergenic
917926646 1:179794780-179794802 TATTACATGGGAGTGAACCCTGG + Intronic
919326126 1:196109345-196109367 TATCACATGGGGAGGAACCTTGG + Intergenic
921330042 1:214026327-214026349 TATTTCGTGGGGCTGAAATTTGG - Intronic
1063466223 10:6246722-6246744 TATTGCATGATGCTGAAGCTTGG + Intergenic
1064931066 10:20627719-20627741 TATCACATGGGGTTGTAAGTAGG - Intergenic
1066161739 10:32740115-32740137 GTTTATAGGGGGCTGAAACTGGG + Intronic
1066497531 10:35956700-35956722 TATTACATGATGCTGAAGTTTGG + Intergenic
1066625184 10:37398768-37398790 TATTACATGATGCTGAAGTTTGG + Intergenic
1067501581 10:46809781-46809803 TATGACCTGGGGCTGAAAGCAGG - Intergenic
1068412825 10:56679625-56679647 AAGTATATGAGGCTGAAACTTGG - Intergenic
1069623099 10:69849858-69849880 TATGGGATGGGGCTGAAACTGGG + Intronic
1075318599 10:121471452-121471474 GATAACAAGGGCCTGAAACTGGG - Intergenic
1076174359 10:128355739-128355761 TGTAATATGGGGCTGAAAGTGGG + Intergenic
1077827048 11:5822041-5822063 TATTACATGATGCTGAAGTTTGG - Intronic
1078019305 11:7642018-7642040 TGTGACATGAGGCAGAAACTGGG + Intronic
1078755539 11:14205262-14205284 TATTACATGTGTCTGAATCTTGG + Intronic
1079089455 11:17470510-17470532 TGTTAAATGGGGCTGTCACTGGG - Intronic
1079920741 11:26431336-26431358 TATTACATGATGCTGAGATTTGG + Intronic
1084768296 11:71326429-71326451 AATTGAATGGTGCTGAAACTTGG - Intergenic
1084845906 11:71899720-71899742 TATCACATGGGGAGAAAACTTGG - Intronic
1084895760 11:72266668-72266690 TGCAACATGGGGCTGAAAATAGG - Intergenic
1085300449 11:75455449-75455471 TGTTACATGGGCCTGGAGCTTGG - Intronic
1087184853 11:95178566-95178588 AATTAGATTAGGCTGAAACTAGG + Intronic
1087691727 11:101328019-101328041 TATTTCATGGGGCTTAAAGCTGG + Intergenic
1088329139 11:108632294-108632316 TATTTCATGGGGGTGCATCTGGG - Intergenic
1088433592 11:109785199-109785221 TAGTACATTGGGCTGAATCTAGG - Intergenic
1089856108 11:121546177-121546199 TATGACATGGGGATGACAATTGG + Intronic
1092513154 12:9179434-9179456 TAATTCATGGGGGTGACACTTGG - Intronic
1096645019 12:53028209-53028231 TACTTCATGGAGCAGAAACTGGG + Intronic
1096869525 12:54584662-54584684 TATTACATGGTGCTGAAGTCTGG - Intronic
1097132434 12:56822475-56822497 TATCACATGGGGCAAAACCTTGG - Intergenic
1097963844 12:65558266-65558288 TGAAGCATGGGGCTGAAACTTGG - Intergenic
1098101235 12:67019020-67019042 TATTAAATGGGGCTGATAACAGG + Intergenic
1098406366 12:70131010-70131032 TATTACATAGGGCTGAAGTCTGG + Intergenic
1099459283 12:82902797-82902819 TATTACATGAGGCTGAGTCCTGG - Intronic
1099525588 12:83714965-83714987 AATTATATGGGTCAGAAACTTGG + Intergenic
1104101281 12:125614183-125614205 TATTTCATGGTGCTGAGACATGG + Intronic
1104881037 12:132070335-132070357 AAATAAATGGGGCTGAAAATAGG - Intronic
1106932506 13:34682141-34682163 TTTAACATGGAGCTAAAACTTGG - Intergenic
1109637170 13:65136560-65136582 AATTACATGAGGCTGAACTTGGG - Intergenic
1111557295 13:89897221-89897243 TATTACATAGGTCTGCATCTAGG + Intergenic
1112764618 13:102727645-102727667 TATTGCGTGGTGCTGAAATTTGG - Intergenic
1113265288 13:108609604-108609626 TATCAAATGCGGCTGAATCTTGG - Intronic
1114006542 14:18319815-18319837 TATCACATGGGGAGAAAACTTGG - Intergenic
1115326692 14:32147317-32147339 TATGACATGTGGCTAAAACAGGG + Intronic
1119586614 14:75841645-75841667 GTTTACATGGGGCTGTAAATCGG + Intronic
1119841332 14:77795283-77795305 TATCACATGGGGAGAAAACTTGG + Intergenic
1119873408 14:78035987-78036009 TATCACATAGGGCTGGAAATAGG - Intergenic
1121076647 14:91074551-91074573 AATTATATGGGGCAGAAATTGGG - Intronic
1121600750 14:95201252-95201274 TATTGCATGATGCTGAAGCTTGG + Intronic
1121601477 14:95207866-95207888 TACAACATGCAGCTGAAACTGGG - Intronic
1121827222 14:97020210-97020232 TTTTCAATGGGGCTGAAACTAGG - Intergenic
1124143060 15:27094438-27094460 TATTATCTGGGGCTGAGACTGGG - Intronic
1124798262 15:32803956-32803978 TAACACATGGGGCCGAAAGTAGG + Intronic
1125888439 15:43247419-43247441 TATTACATGATGCTGAAGTTTGG - Intronic
1126339474 15:47623233-47623255 TAACACATGAGGCTGAGACTGGG - Intronic
1128363444 15:66979509-66979531 TATTGCATGGTGCTGAGATTTGG + Intergenic
1129274708 15:74437322-74437344 TATTGCAGGGGGCAGAGACTTGG + Intergenic
1135289409 16:21222395-21222417 TATCACATGGGGAGAAAACTTGG + Intergenic
1137015306 16:35368310-35368332 CATCACAAGGTGCTGAAACTTGG + Intergenic
1139978724 16:70836087-70836109 TATTACATGGGGCTGAAACTAGG + Intronic
1140599448 16:76457854-76457876 TATTGCATGGTGCTGAGATTTGG + Intronic
1144230210 17:13195092-13195114 CATTCCATGGGGCAAAAACTTGG + Intergenic
1146211657 17:30947945-30947967 CAGTAAATGGGGCTGCAACTGGG + Intronic
1146511713 17:33455249-33455271 TATTGCATGATGCTGAAATTTGG + Intronic
1151006819 17:70447526-70447548 TATTAGATGTTGCTGACACTTGG + Intergenic
1151666115 17:75546048-75546070 TATTCCATGGGTCTCAAACCAGG - Intronic
1153466284 18:5391269-5391291 TATTACATGAGTCAGAAACCTGG - Intergenic
1155684890 18:28536472-28536494 TATTGCATGTTGCTGAAATTTGG - Intergenic
1156625571 18:38903513-38903535 TATGACATGGGGCAGAAATCAGG + Intergenic
1156920420 18:42515671-42515693 TTTTTCATGGAGCTGCAACTAGG + Intergenic
1157664843 18:49477114-49477136 AATTACTTGAGGCTAAAACTTGG - Intergenic
1158217523 18:55115671-55115693 TATAACATGGGTCTGAACCTTGG - Intergenic
1160226084 18:77012167-77012189 TATGAGATGAAGCTGAAACTTGG - Intronic
1161025575 19:2035173-2035195 TATTATATGGGGCGGAGCCTTGG - Intergenic
1163500417 19:17672898-17672920 CATTAGATGGGGATGACACTGGG - Intronic
1164390414 19:27814931-27814953 TATCACATGGGGAGAAAACTTGG - Intergenic
929352559 2:40976009-40976031 TATTACATGATGCTGAAGTTTGG + Intergenic
930147716 2:48024317-48024339 AATGACATGGTCCTGAAACTTGG - Intergenic
930863743 2:56102773-56102795 TATTACATGTGCCTGCAGCTAGG - Intergenic
931986737 2:67749498-67749520 TATTACATGATGCTGAGATTTGG + Intergenic
932252871 2:70259398-70259420 TATTACCTGCGGCAGAAATTTGG + Exonic
933192531 2:79351490-79351512 TATTACATGATGCTGAGATTAGG + Intronic
937009782 2:118552174-118552196 TCTTACATGGGTCAGAAGCTGGG + Intergenic
941565996 2:167108960-167108982 TATTACATGGGTAACAAACTTGG + Intronic
942336825 2:174897540-174897562 TATTACATGGAGCTAAACTTTGG - Intronic
943081929 2:183266523-183266545 TATTGCATGGCGCTGAGACTTGG + Intergenic
944960711 2:204869676-204869698 TGTTACATTGGGCTGAGACATGG + Intronic
1169303752 20:4470236-4470258 TATTTCATGGAGTTGAAACTTGG - Intergenic
1169939673 20:10923690-10923712 TATTACATAGTGCTGAAATCTGG - Intergenic
1169993731 20:11533308-11533330 TATTGCGTGGTGCTGAAATTTGG - Intergenic
1172869507 20:38126957-38126979 TATTTCAGGGGGCTGGAAGTTGG + Intronic
1173715732 20:45203179-45203201 TATTGCATGATGCTGAAGCTCGG - Intergenic
1175261708 20:57678746-57678768 TATTACTTGGGGCAGACAATAGG - Intronic
1175431419 20:58906968-58906990 TATTACAAGTAGCTGAAACTCGG + Intronic
1175560282 20:59921049-59921071 TATTAACTGTGGCTGAAACTGGG - Intronic
1176766485 21:13024079-13024101 TATTACATGGGGAGAAACCTTGG - Intergenic
1177662606 21:24105585-24105607 TATTGCATGATGCTGAAGCTTGG - Intergenic
1180431051 22:15250626-15250648 TATCACATGGGGAGAAAACTTGG - Intergenic
1181594826 22:23907420-23907442 TATCACATGGGGATAAACCTTGG - Intergenic
949643887 3:6071018-6071040 TTTTAGATGGGTCTGAAACGGGG - Intergenic
951515839 3:23558436-23558458 TTTTACATGAGTCTGAGACTCGG - Intronic
951924433 3:27892073-27892095 TATAACATTATGCTGAAACTTGG - Intergenic
952411445 3:33053421-33053443 AGTTACATGCTGCTGAAACTGGG - Intronic
955904935 3:63796850-63796872 AATTATATGGCGCAGAAACTTGG - Intergenic
956021236 3:64935300-64935322 TATATCATGAGGCTGAAAATGGG + Intergenic
956021411 3:64937290-64937312 TATATCATGAGGCTGAAAATTGG + Intergenic
957588308 3:82161028-82161050 TATTGCATGATGCTGAAGCTTGG - Intergenic
959930114 3:111971379-111971401 ATTTACATGGGTCTGAAGCTTGG - Intronic
965196808 3:165608931-165608953 TTTACCATGGGTCTGAAACTAGG - Intergenic
965280716 3:166748369-166748391 TATTACATGGTTCTGAAATTTGG - Intergenic
966016589 3:175147152-175147174 TATTGCATGATGCTGAAATTTGG + Intronic
966380209 3:179337316-179337338 AATTATATGGTTCTGAAACTTGG - Intergenic
968375898 4:41147-41169 TATTACATGGGGAGAAACCTTGG + Intergenic
970810381 4:20086616-20086638 TACTACATGAGGCTAGAACTTGG + Intergenic
970944581 4:21675848-21675870 TTTTACATGACACTGAAACTTGG - Intronic
971087291 4:23293637-23293659 CATTACATGGCTCTGAACCTGGG - Intergenic
971870605 4:32232666-32232688 TATAAAGTGGGGCTGAAACATGG + Intergenic
973714390 4:53660754-53660776 TATTACATGAGGCTGAGGTTTGG - Intronic
977664487 4:99630088-99630110 TGTTACATGAAACTGAAACTGGG + Intergenic
978134633 4:105242581-105242603 AATTACATGTGGGTGAAAATGGG - Intronic
979497195 4:121396892-121396914 TATCACATGGGGATAAACCTTGG - Intergenic
980245252 4:130230693-130230715 AATTTCATGGAGCTGGAACTGGG - Intergenic
981231608 4:142362923-142362945 TATTGCATGAGGCTGAGATTTGG - Intronic
982145797 4:152389694-152389716 TATTACATAGTGGTGAAATTTGG - Intronic
983671178 4:170239587-170239609 TATTGCATGAGGCTGAGGCTTGG + Intergenic
987936037 5:24466105-24466127 TATTACATGGGGAGAAACCTTGG - Intergenic
989245814 5:39253326-39253348 TATTTCATGGGAATAAAACTAGG - Intronic
989403079 5:41029894-41029916 TATTGCATGATGCTGAGACTTGG - Intronic
992170093 5:74092979-74093001 TATTAAAAGGGACTGAAAGTAGG + Intergenic
992235591 5:74705827-74705849 TATTACAGGGGTATTAAACTAGG - Intronic
992253413 5:74897904-74897926 TATTACAGGGGTATTAAACTAGG - Intergenic
993178996 5:84524515-84524537 TAATACATAGTTCTGAAACTAGG + Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1006575043 6:35038955-35038977 TATTACCATGGGCAGAAACTAGG - Intronic
1009193300 6:60655350-60655372 TATTACATGGGGAGAAACCTTGG - Intergenic
1009193714 6:60660321-60660343 TATTACATGGAGATAAACCTTGG - Intergenic
1010713582 6:79203762-79203784 TGTTACCTGGTGCTGAAAATAGG - Intronic
1012526534 6:100184587-100184609 TATTACATGGGGAGGAGAGTTGG + Intergenic
1013831651 6:114280002-114280024 AATTACATGGTACTGGAACTAGG + Intronic
1014508046 6:122283032-122283054 TATAGCATGAGACTGAAACTTGG + Intergenic
1015396626 6:132741901-132741923 TAATACAGGGGGCTGTAACCAGG + Intergenic
1018237612 6:161741603-161741625 TCATCCATGGGGCTGATACTGGG - Intronic
1021306827 7:19042556-19042578 TATTACATGCTGCTGAAGTTTGG + Intronic
1021509392 7:21418998-21419020 TATTGCATGGTGCTGAGATTTGG + Intergenic
1025101420 7:56138459-56138481 TATTACATGATGCTGAAGTTGGG - Intergenic
1026652505 7:72227674-72227696 TATTGCATGATGCTGAAGCTTGG - Intronic
1027622010 7:80499852-80499874 TATAAAATTGGGCTAAAACTTGG + Intronic
1031230630 7:119100851-119100873 TATCACATGGGGAGAAAACTTGG + Intergenic
1033914090 7:146302223-146302245 TATTATATGGGACTGAAAAGGGG - Intronic
1036251475 8:7166396-7166418 TACTACATGTGGATGGAACTTGG + Intergenic
1036366013 8:8121064-8121086 TACTACATGTGGATGGAACTTGG - Intergenic
1038131349 8:24735098-24735120 TATTACATAGGGAAGAACCTGGG + Intergenic
1044331470 8:90925075-90925097 TATGATATGGGGGTGAAACGAGG + Intronic
1045344106 8:101279324-101279346 TATTACATGATGCTGAGGCTTGG - Intergenic
1045755362 8:105534688-105534710 AAATACATGTGGCTGAAACCAGG + Intronic
1045996260 8:108365478-108365500 AATTACATAGGTCAGAAACTTGG - Intronic
1046790155 8:118313045-118313067 TATTACATAGGTCTCAAAATTGG + Intronic
1046948082 8:119993365-119993387 TATTAAATGGGATTTAAACTAGG - Intronic
1047919816 8:129623309-129623331 TATTACATGATGCTGAGATTTGG + Intergenic
1048523601 8:135180214-135180236 TATTGCATGGTTCTCAAACTTGG + Intergenic
1052101091 9:24447036-24447058 TATTACATGGGGCTGGAGAGTGG + Intergenic
1052532153 9:29700111-29700133 TATTACATGATGCTGAAGTTTGG - Intergenic
1055195198 9:73582374-73582396 TGCTACATAGGGCTGAAACTAGG - Intergenic
1055280767 9:74671696-74671718 TATGAAATGGGTCTGAAGCTTGG + Intronic
1057295793 9:93839289-93839311 TATTGCATGATGCTGAAATTTGG + Intergenic
1058107752 9:100992442-100992464 GATTATCTGGGGTTGAAACTTGG - Intergenic
1059509638 9:114832563-114832585 TATTGCATGGTGCTGAAGTTTGG + Intergenic
1061547891 9:131315320-131315342 TGTGAAATGGGGCTGATACTTGG + Intergenic
1203573330 Un_KI270744v1:153003-153025 TATTACATGGGGAGAAACCTTGG - Intergenic
1186677559 X:11834890-11834912 TTTCACTTGGGGTTGAAACTTGG + Intergenic
1187190698 X:17032164-17032186 GATTACATGGGTCTGGAGCTTGG + Intronic
1187321397 X:18241309-18241331 AAGTATATGGGGCTGAAGCTGGG - Exonic
1188131388 X:26437645-26437667 AATAACATCTGGCTGAAACTTGG + Intergenic
1188552307 X:31377592-31377614 TATTACCTGGGTTTGAATCTTGG + Intronic
1189361203 X:40353584-40353606 TATTGCATGGGGCTGAGGTTTGG + Intergenic
1191033342 X:55998379-55998401 TATTACATGGGGAGAAACCTTGG + Intergenic
1198565361 X:137898805-137898827 TATTACATGAGGCTGAAGTTTGG + Intergenic
1199561680 X:149170223-149170245 TATTACATGAAGCTGAAGTTGGG - Intergenic