ID: 1139981882

View in Genome Browser
Species Human (GRCh38)
Location 16:70865817-70865839
Sequence CAGACAATATCCACACTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139981882_1139981892 18 Left 1139981882 16:70865817-70865839 CCCACCAGTGTGGATATTGTCTG 0: 2
1: 0
2: 0
3: 8
4: 71
Right 1139981892 16:70865858-70865880 GGGCAAAAAGAACAGATCCTGGG 0: 2
1: 0
2: 1
3: 18
4: 231
1139981882_1139981887 -10 Left 1139981882 16:70865817-70865839 CCCACCAGTGTGGATATTGTCTG 0: 2
1: 0
2: 0
3: 8
4: 71
Right 1139981887 16:70865830-70865852 ATATTGTCTGGGTTACCACTTGG 0: 2
1: 0
2: 0
3: 4
4: 99
1139981882_1139981891 17 Left 1139981882 16:70865817-70865839 CCCACCAGTGTGGATATTGTCTG 0: 2
1: 0
2: 0
3: 8
4: 71
Right 1139981891 16:70865857-70865879 TGGGCAAAAAGAACAGATCCTGG 0: 2
1: 0
2: 2
3: 18
4: 377
1139981882_1139981888 -3 Left 1139981882 16:70865817-70865839 CCCACCAGTGTGGATATTGTCTG 0: 2
1: 0
2: 0
3: 8
4: 71
Right 1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG 0: 2
1: 0
2: 0
3: 9
4: 115
1139981882_1139981889 -2 Left 1139981882 16:70865817-70865839 CCCACCAGTGTGGATATTGTCTG 0: 2
1: 0
2: 0
3: 8
4: 71
Right 1139981889 16:70865838-70865860 TGGGTTACCACTTGGTGCATGGG 0: 2
1: 0
2: 0
3: 3
4: 61
1139981882_1139981893 21 Left 1139981882 16:70865817-70865839 CCCACCAGTGTGGATATTGTCTG 0: 2
1: 0
2: 0
3: 8
4: 71
Right 1139981893 16:70865861-70865883 CAAAAAGAACAGATCCTGGGTGG 0: 2
1: 0
2: 0
3: 41
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139981882 Original CRISPR CAGACAATATCCACACTGGT GGG (reversed) Intronic
900782669 1:4628326-4628348 GAAACAATATCCACCCTGGGAGG + Intergenic
909181823 1:72433846-72433868 CATAAAATCCCCACACTGGTTGG - Intergenic
912381173 1:109249066-109249088 CAGACAACAGCCTCGCTGGTGGG + Intergenic
914352148 1:146849715-146849737 CAGACAATATCCACACTGGTGGG + Intergenic
916051976 1:161042625-161042647 CTGGCAATAGCCACACTGGTTGG + Exonic
1065982134 10:30909887-30909909 CACAAAATATCCACACAAGTAGG + Intronic
1068408036 10:56618522-56618544 CAAACAATCCCCACACTGATGGG + Intergenic
1070491107 10:76977419-76977441 CAGACCATAGCCACAGTTGTTGG + Intronic
1075228508 10:120650885-120650907 CAGACAATATGCAAACAGGTGGG + Intergenic
1075781584 10:125020820-125020842 CAGACCCCCTCCACACTGGTGGG - Intronic
1077972459 11:7208765-7208787 AAGAAAATATCCTCACTTGTTGG + Intergenic
1078934483 11:15939467-15939489 TACACAATATCCACTCTGTTTGG + Intergenic
1079788256 11:24702756-24702778 CATAGAAGATCCACACTGCTTGG - Intronic
1086515892 11:87612983-87613005 CAAACCATATCAGCACTGGTGGG - Intergenic
1090515806 11:127425240-127425262 CAGACAATATGTACATTGATAGG - Intergenic
1093672435 12:21893240-21893262 GAGACAAAATCTGCACTGGTTGG + Intronic
1096103980 12:48986140-48986162 CAGACACTGTGCACACAGGTGGG - Intergenic
1102934264 12:116883362-116883384 CAGACAACATCCAAGCTGCTGGG - Intergenic
1108888902 13:55228391-55228413 CAAACAATACCCACACTTGATGG - Intergenic
1109314178 13:60730595-60730617 CAGACATTATCCACACTTGGTGG - Intergenic
1110019338 13:70450265-70450287 TACACAATATCAAAACTGGTAGG - Intergenic
1110576714 13:77065283-77065305 GAGAAAATATCCACGCTGTTGGG + Intronic
1115760919 14:36579331-36579353 TAGACAAAATCCGCACTGTTTGG - Intergenic
1126166983 15:45661967-45661989 CAGCCAATCTGGACACTGGTGGG + Exonic
1127733679 15:61822271-61822293 CAGACAATATATAAACTAGTGGG + Intergenic
1138678041 16:58665977-58665999 CAGACAAAATCCAGACTGGAAGG + Exonic
1139742075 16:69044035-69044057 AACACAATATCCACATTGGAGGG + Intronic
1139981882 16:70865817-70865839 CAGACAATATCCACACTGGTGGG - Intronic
1140824741 16:78695534-78695556 CAGACCATAGCCTCACAGGTGGG - Intronic
1157808763 18:50678449-50678471 CAGACAGTATCTACTCTGATTGG - Intronic
1159389909 18:67777640-67777662 GAAACAATTTGCACACTGGTAGG - Intergenic
1160169780 18:76543622-76543644 CAGGCAAAATCCAAACTGCTGGG + Intergenic
1163324158 19:16592427-16592449 CAGGAAATATCCAGGCTGGTGGG + Intronic
929648462 2:43653744-43653766 GAGACAATTTACACAGTGGTGGG + Intronic
932515330 2:72341475-72341497 CAGACAAAATACACACTTTTTGG + Intronic
934188901 2:89767432-89767454 CAGACAGAATCTACACTGCTTGG - Intergenic
935389844 2:102539537-102539559 CAGACAATATCCACAGTTCTTGG + Intergenic
935422338 2:102882387-102882409 CCGACAATGTCTACACTGGCTGG - Intergenic
936030132 2:109064068-109064090 CAGACAATAAACACAGTGCTTGG - Intergenic
938812346 2:134865163-134865185 CAGGCAATCTCCTGACTGGTGGG - Intronic
1173701228 20:45073655-45073677 CTGACATTATCCACAGTGGGTGG - Intronic
1176672739 21:9750098-9750120 CAGAAAACATCCAGACTGTTGGG - Intergenic
1181736308 22:24884376-24884398 CATTCAATCTCCACACTGATGGG - Intronic
1184719395 22:46301370-46301392 GAGACAATTTCTACACTGCTGGG - Intronic
951601886 3:24385913-24385935 CAGACCATAGCCACAGTGGCAGG + Intronic
966518489 3:180846500-180846522 CAGAGAATATCCACACATGAAGG - Intronic
969130244 4:4985823-4985845 CAGGCAGTGTCCACACTGGCAGG + Intergenic
971163438 4:24157764-24157786 CAGACCAAATCAACAATGGTGGG - Intergenic
976447114 4:85142713-85142735 CAAACAAGATCCACATTGCTTGG + Intergenic
982160765 4:152567254-152567276 CAAACAATAGCTACACTGTTTGG - Intergenic
985401976 4:189601727-189601749 CAGAAAAAATCCAGACTGTTGGG + Intergenic
995051226 5:107706505-107706527 CAGCCAATATCCAATCAGGTAGG + Intergenic
1003902844 6:10670849-10670871 CAGTCAATATACACATTGGCTGG + Intergenic
1008678595 6:53847611-53847633 GAGACAATGTCCCTACTGGTAGG - Intronic
1016074930 6:139784674-139784696 CAGACAATCTACAGAGTGGTAGG - Intergenic
1017609388 6:156168260-156168282 CAGAGACTATGCACACTGGGAGG + Intergenic
1019035989 6:169059064-169059086 CAGAGAATATCCACACAGAAAGG - Intergenic
1021079537 7:16347690-16347712 GAGAAAACATCCACACTGGATGG + Intronic
1027970487 7:85074369-85074391 TAGACAATAACCTAACTGGTAGG + Intronic
1033574281 7:142665115-142665137 CAGGCAATATGCACAGTTGTAGG - Intergenic
1034543100 7:151772036-151772058 CAGACAGTTTACACTCTGGTGGG + Intronic
1035728383 8:1838817-1838839 CAGACAGCAACCACACTGGACGG - Intronic
1041305245 8:56450898-56450920 CAGACAATTTCCACAGTTGAAGG + Intergenic
1042272063 8:66964454-66964476 CCGACAAGATTCACACTGTTTGG - Intronic
1047384651 8:124397534-124397556 CAGAACATATCCCCACTGTTAGG - Intergenic
1048483953 8:134831008-134831030 CAGAGAAGCTCCAAACTGGTGGG + Intergenic
1050409879 9:5352543-5352565 TAGATAATATCCACACTGATGGG + Intergenic
1051499784 9:17764504-17764526 CATTCAGTATCCACACTGGTTGG - Intronic
1056624371 9:88242207-88242229 AAGACAAATTACACACTGGTAGG + Intergenic
1056734239 9:89191964-89191986 CAGGCAATAGCCACAGTAGTTGG + Intergenic
1058146891 9:101422411-101422433 CAGACAATAGCAACACTGACTGG - Intronic
1058645685 9:107129816-107129838 CAAACAATACCCACTCTGCTGGG - Intergenic
1059507512 9:114813276-114813298 CAGCCAGAATCCACTCTGGTGGG - Intergenic
1060018186 9:120105378-120105400 CAGTCAAAATCCTCACTGTTTGG + Intergenic
1061545413 9:131301559-131301581 CAGACAATTTTGACCCTGGTGGG + Intronic
1187434579 X:19255515-19255537 CACTCAATAATCACACTGGTAGG + Intergenic
1190303570 X:49069803-49069825 AAGACATTACCCACACTGGAAGG + Intronic
1193945368 X:87727654-87727676 CAGACAATATACACACTGAGAGG + Intergenic
1196175625 X:112636378-112636400 TAGACAATATCGACACTTTTTGG - Intronic
1199947083 X:152678964-152678986 CAGACACCATCCACACAGGATGG + Intergenic
1199962598 X:152789490-152789512 CAGACACCATCCACACAGGATGG - Intergenic