ID: 1139981886

View in Genome Browser
Species Human (GRCh38)
Location 16:70865821-70865843
Sequence AACCCAGACAATATCCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139981886_1139981891 13 Left 1139981886 16:70865821-70865843 CCAGTGTGGATATTGTCTGGGTT 0: 2
1: 0
2: 1
3: 9
4: 128
Right 1139981891 16:70865857-70865879 TGGGCAAAAAGAACAGATCCTGG 0: 2
1: 0
2: 2
3: 18
4: 377
1139981886_1139981892 14 Left 1139981886 16:70865821-70865843 CCAGTGTGGATATTGTCTGGGTT 0: 2
1: 0
2: 1
3: 9
4: 128
Right 1139981892 16:70865858-70865880 GGGCAAAAAGAACAGATCCTGGG 0: 2
1: 0
2: 1
3: 18
4: 231
1139981886_1139981893 17 Left 1139981886 16:70865821-70865843 CCAGTGTGGATATTGTCTGGGTT 0: 2
1: 0
2: 1
3: 9
4: 128
Right 1139981893 16:70865861-70865883 CAAAAAGAACAGATCCTGGGTGG 0: 2
1: 0
2: 0
3: 41
4: 372
1139981886_1139981888 -7 Left 1139981886 16:70865821-70865843 CCAGTGTGGATATTGTCTGGGTT 0: 2
1: 0
2: 1
3: 9
4: 128
Right 1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG 0: 2
1: 0
2: 0
3: 9
4: 115
1139981886_1139981889 -6 Left 1139981886 16:70865821-70865843 CCAGTGTGGATATTGTCTGGGTT 0: 2
1: 0
2: 1
3: 9
4: 128
Right 1139981889 16:70865838-70865860 TGGGTTACCACTTGGTGCATGGG 0: 2
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139981886 Original CRISPR AACCCAGACAATATCCACAC TGG (reversed) Intronic
903157449 1:21456049-21456071 AACCCTGACAAAATCCACAAAGG + Intronic
909548415 1:76872204-76872226 TACCCAGACGAGATCCAGACTGG - Intronic
913096399 1:115521198-115521220 AACCCAGACAATAAGCAACCAGG - Intergenic
913544807 1:119857878-119857900 AACCCTGTCAAAATCCACAAAGG - Intergenic
913992192 1:143625056-143625078 AACCCTGACACCATCCACAAAGG - Intergenic
914352144 1:146849711-146849733 AACCCAGACAATATCCACACTGG + Intergenic
916407593 1:164513007-164513029 CACCCAGGAAAGATCCACACAGG - Intergenic
917666903 1:177233901-177233923 AACAGAGACAATATGCACTCTGG + Intronic
919492543 1:198223601-198223623 AAGCAAGACAATATTCAGACAGG + Intronic
920207217 1:204301289-204301311 AACCCAGAGACTCTCCAGACTGG - Intronic
920816628 1:209340547-209340569 AACCCAGACAAGACCAAGACAGG - Intergenic
921142179 1:212319550-212319572 AGCACAGACAATATCTGCACTGG - Intronic
923288451 1:232520292-232520314 AACCCAGACAGAAACCCCACAGG + Intronic
1063055562 10:2500759-2500781 AACACACACAATAAACACACAGG + Intergenic
1066350979 10:34636501-34636523 AACCCAGACAGTTACCGCACAGG + Intronic
1067855131 10:49785521-49785543 AAAACAGACAAAATCCACATAGG + Intergenic
1071854283 10:89607777-89607799 AACCCACAGAATATAGACACTGG + Intronic
1074283423 10:112075226-112075248 AACCCAGACAACATTGACAGAGG + Intergenic
1077858771 11:6156884-6156906 AACTCAGCCAATACCCACAGAGG + Intergenic
1079941003 11:26680632-26680654 AAACCAAACAATATGAACACAGG - Intronic
1080457054 11:32427580-32427602 AACCCATCCAATGGCCACACCGG - Intronic
1082859695 11:57843002-57843024 CACCCAGACAATATACAAACAGG + Intergenic
1085960430 11:81455311-81455333 GTCCAAGACATTATCCACACAGG + Intergenic
1089079616 11:115764747-115764769 AACCCAGAGAACTTCCAGACAGG - Intergenic
1090077444 11:123588144-123588166 AAACCAGTTAAGATCCACACAGG - Intronic
1093443185 12:19224030-19224052 AACCTAGACAACAATCACACAGG - Intronic
1101437875 12:104679601-104679623 ATCCCACTCAAAATCCACACAGG - Intronic
1101900327 12:108787245-108787267 AACCCATACATTTTCCCCACCGG + Exonic
1102782993 12:115581638-115581660 AACTCAGACAAGGTGCACACAGG - Intergenic
1104659044 12:130595895-130595917 AATGCCAACAATATCCACACTGG - Intronic
1105410207 13:20165252-20165274 AGCCCAGAAAATTTCCACAGGGG - Intergenic
1108597194 13:51959815-51959837 AACCTAAACAATATGCACATTGG + Intronic
1108759224 13:53542630-53542652 AACCAAGACAAACTTCACACTGG + Intergenic
1113400468 13:109988000-109988022 AACCAATACCATATCCACAACGG + Intergenic
1113542519 13:111120164-111120186 AACCCAAACAAGAATCACACTGG - Intronic
1115843045 14:37493776-37493798 AACTTACACAATATCCACATAGG - Intronic
1116806879 14:49502406-49502428 AAACCAGACAAAGTGCACACTGG + Intergenic
1118084533 14:62399407-62399429 AACACAGCCAATACCCACAAAGG - Intergenic
1122097851 14:99384379-99384401 AACGCAGCCAATAGCAACACAGG - Intergenic
1123928209 15:25139718-25139740 AACCCAAACTGTAACCACACAGG - Intergenic
1129493222 15:75950011-75950033 ATCCCAGACAAAATCCCAACAGG - Intronic
1132223187 15:100120169-100120191 CATCCAGACAATAATCACACTGG + Intronic
1132528225 16:428231-428253 TACCCTGACAATATCCCAACCGG - Intronic
1135466650 16:22692400-22692422 AAACCAGAAAATATTCACAGAGG - Intergenic
1135847602 16:25932852-25932874 AACCTAGACATTTTCCAGACAGG + Intronic
1138292177 16:55857044-55857066 AAGCCAGAAAATTTCCAAACTGG + Intronic
1139742072 16:69044031-69044053 AGCCAACACAATATCCACATTGG + Intronic
1139981886 16:70865821-70865843 AACCCAGACAATATCCACACTGG - Intronic
1155688336 18:28583364-28583386 AACACAGACTGTATCCTCACAGG - Intergenic
1157139815 18:45094454-45094476 TACCCAGACTTTCTCCACACAGG - Intergenic
1160344223 18:78118549-78118571 AACCCAGACAATAACCTAAATGG - Intergenic
1161572677 19:5038994-5039016 AGCCCAGACACTATCCCCAGTGG - Intronic
1165225929 19:34354957-34354979 AACACAGACAAGAGCCACGCAGG - Exonic
1166348295 19:42180401-42180423 AACCCACACACTATCCATTCTGG + Intronic
931407006 2:61988884-61988906 AACTCAGCCAATGTCCACAGAGG - Intronic
932702958 2:74003343-74003365 AATCCAAACAAAACCCACACAGG - Intronic
934080395 2:88462854-88462876 ATCCCAGATAATATCCAAAAAGG + Intergenic
934525878 2:95051269-95051291 AGTCCAGACACCATCCACACAGG - Intronic
934668896 2:96195312-96195334 AACCCAAAAGATAGCCACACTGG + Intronic
934673242 2:96230454-96230476 AAGTCAGACAAGAGCCACACAGG - Intergenic
935358630 2:102228278-102228300 AACTCAGAAAATATCCTCAAGGG - Intronic
937461906 2:122096505-122096527 AACCCAGCCAGCATCCACTCTGG + Intergenic
939668399 2:144978811-144978833 TAGCCAGCCAATGTCCACACTGG - Intergenic
942320499 2:174731783-174731805 ACCACAGAGAATATCCTCACTGG + Intergenic
946888835 2:224252737-224252759 AACCCAGTAAATATGCACAAAGG + Intergenic
948677751 2:239608987-239609009 AGCCCTGACAATACCCAGACAGG - Intergenic
1170639580 20:18139541-18139563 AACCCAGAGAATTTTAACACAGG + Intronic
1177566041 21:22821551-22821573 AAGCCACATAATATCCACAAAGG + Intergenic
1178332405 21:31710064-31710086 AATCCAGACAATATACAGGCAGG - Intronic
1181493255 22:23273919-23273941 CACCCAGACACCTTCCACACAGG - Intronic
1182118011 22:27768506-27768528 CACCCAGACTTTATGCACACTGG + Intronic
1182285384 22:29243893-29243915 AATGAAGACAATATCTACACAGG + Intronic
1182846962 22:33439305-33439327 AACCTAGACATTATGAACACTGG - Intronic
1183368470 22:37419373-37419395 CACCCAGACAGAATCCACACAGG + Intronic
949625597 3:5863201-5863223 AATCCACACAATATCCTCAGGGG - Intergenic
952912017 3:38199036-38199058 AAACCAGACAATATAAAAACAGG + Intronic
955108569 3:55924856-55924878 ATCCAAGAGTATATCCACACAGG - Intronic
957639729 3:82836453-82836475 AAGCCAGACAACATCCCTACTGG - Intergenic
957933144 3:86908474-86908496 AACACAGACAATTTCAACACTGG - Intergenic
962208935 3:133460049-133460071 ACACCAGCCAACATCCACACTGG - Intronic
963611042 3:147468666-147468688 AAACTAGACAATATCCTCATGGG - Intronic
964381544 3:156102961-156102983 AACCCAGACAGTATCTACTTGGG + Intronic
969118750 4:4891221-4891243 AATGCAGAGAATTTCCACACTGG - Intergenic
970708632 4:18835830-18835852 CTCCCATAAAATATCCACACAGG - Intergenic
971765255 4:30822539-30822561 AATGCACACAATATCCCCACAGG - Intronic
973924240 4:55721013-55721035 AACCTAAAAAATTTCCACACTGG - Intergenic
974735833 4:65930712-65930734 AACCCAGATAATTTTCACATAGG - Intergenic
976012235 4:80504247-80504269 GAGCCAGAATATATCCACACTGG - Intronic
980562761 4:134499584-134499606 AAGCCAGACAATATACTCATTGG - Intergenic
984880880 4:184409122-184409144 AAGTCAGACAAAAGCCACACAGG + Intronic
984979013 4:185259745-185259767 AACCGTGTCCATATCCACACAGG - Intronic
985517304 5:353708-353730 GACCCAGACCATCTCCCCACAGG + Exonic
986247061 5:6018589-6018611 GACCCACGCAAAATCCACACTGG + Intergenic
988844905 5:35117930-35117952 AAACCAGTCAATGTCTACACTGG - Intronic
988925934 5:35991147-35991169 AATCCTGACAATATCTACACTGG - Exonic
989651795 5:43698339-43698361 AATCCAGAGAAAACCCACACAGG - Intronic
991157541 5:63457266-63457288 AAAACAGACAATAACAACACAGG - Intergenic
992851044 5:80807882-80807904 TACCCAGAGAAAATCCACACAGG + Intronic
992884677 5:81146288-81146310 CACACAGACAATAGCTACACAGG - Intronic
1000212794 5:159123362-159123384 AAACCAGACAATGACCTCACTGG - Intergenic
1001422851 5:171600374-171600396 AACCCACACACTCTCCCCACAGG - Intergenic
1007413750 6:41680046-41680068 AATTCAGATAATATCCACAGGGG - Intergenic
1008743770 6:54643258-54643280 CCCCCACACAATATCCACAGGGG - Intergenic
1010778898 6:79920703-79920725 ACCACAGATAATGTCCACACGGG - Intronic
1014987391 6:128028554-128028576 ACCAGAGACCATATCCACACTGG - Intronic
1018224108 6:161611081-161611103 AAACCAGACAAAAACCACAGTGG - Intronic
1018300451 6:162396930-162396952 CACACACACAATATACACACAGG + Intronic
1021079536 7:16347686-16347708 AACTGAGAAAACATCCACACTGG + Intronic
1023743794 7:43303510-43303532 AAGCCAGATAATATCCACACAGG - Intronic
1025020106 7:55473888-55473910 ACCCTACACAATATTCACACAGG - Intronic
1026440300 7:70438181-70438203 AACCCAGGCAATAACTACTCAGG - Intronic
1026440895 7:70442850-70442872 AACCCAGACAAAATCCTGAAGGG - Intronic
1026779755 7:73257613-73257635 AAACAAGTCAATACCCACACAGG + Intergenic
1026948714 7:74333119-74333141 CACCCAGACAAGAGCCACAAAGG - Intronic
1027020610 7:74811026-74811048 AAACAAGTCAATACCCACACAGG + Intronic
1028116684 7:87005015-87005037 AGCCCATACAATATGCACAGAGG - Intronic
1028810611 7:95082037-95082059 TATCCAGACAATCACCACACAGG - Intronic
1032578347 7:133079745-133079767 GACCCAGACAAAAATCACACAGG + Intronic
1033454425 7:141489863-141489885 AACCTGGACAATATTCACAGTGG + Intergenic
1034054786 7:148022597-148022619 AGCCCAGACCAAAACCACACAGG - Intronic
1034870869 7:154682519-154682541 AACCCAGACAATAACCTCTGAGG - Intronic
1035967154 8:4205599-4205621 AGCCCTGACAATTTCCACCCAGG + Intronic
1036053349 8:5224871-5224893 AAACCAGTCAATGTCCTCACAGG - Intergenic
1037570818 8:20156365-20156387 AACCCAGCCAATTTCCTAACAGG + Intronic
1037680850 8:21096275-21096297 AAACCACCCAATATCCACCCTGG + Intergenic
1041237070 8:55814363-55814385 AACCCAGAGAATCTCAACTCTGG - Intronic
1043069484 8:75620693-75620715 AACCAAGACCATATACCCACAGG + Intergenic
1044103764 8:88175301-88175323 TACCCTGACAATATGCAGACAGG - Intronic
1044585220 8:93863523-93863545 AATCAAGACAATATCCTCACTGG + Intronic
1050430615 9:5558144-5558166 AACCCAGGTCATATCCAGACTGG - Intronic
1185576534 X:1179010-1179032 AGCCCAGGCAAGATCCACAGAGG + Intergenic
1186193659 X:7090597-7090619 AACCCAGACAGTATCTGCATTGG + Intronic
1187434576 X:19255511-19255533 AACCCACTCAATAATCACACTGG + Intergenic
1189084873 X:38011718-38011740 ACCCTAGAAAATATCCCCACGGG - Intronic
1190303567 X:49069799-49069821 ACCCAAGACATTACCCACACTGG + Intronic
1192858607 X:75040616-75040638 AACTCAGCCAACATCCACACAGG - Intergenic
1193037855 X:76972909-76972931 AACACAGAAAATACCAACACAGG - Intergenic
1193419257 X:81263994-81264016 AACACAGGCAGTATGCACACAGG - Intronic
1195563396 X:106312077-106312099 AACCCAGTCAATATCCCAACAGG + Intergenic
1198455077 X:136809113-136809135 AATCCAGAGCATATCCACAATGG + Intergenic