ID: 1139981888

View in Genome Browser
Species Human (GRCh38)
Location 16:70865837-70865859
Sequence CTGGGTTACCACTTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139981882_1139981888 -3 Left 1139981882 16:70865817-70865839 CCCACCAGTGTGGATATTGTCTG 0: 2
1: 0
2: 0
3: 8
4: 71
Right 1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG 0: 2
1: 0
2: 0
3: 9
4: 115
1139981881_1139981888 3 Left 1139981881 16:70865811-70865833 CCTATACCCACCAGTGTGGATAT 0: 2
1: 0
2: 1
3: 6
4: 79
Right 1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG 0: 2
1: 0
2: 0
3: 9
4: 115
1139981883_1139981888 -4 Left 1139981883 16:70865818-70865840 CCACCAGTGTGGATATTGTCTGG 0: 2
1: 0
2: 0
3: 1
4: 101
Right 1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG 0: 2
1: 0
2: 0
3: 9
4: 115
1139981886_1139981888 -7 Left 1139981886 16:70865821-70865843 CCAGTGTGGATATTGTCTGGGTT 0: 2
1: 0
2: 1
3: 9
4: 128
Right 1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG 0: 2
1: 0
2: 0
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139981888 Original CRISPR CTGGGTTACCACTTGGTGCA TGG Intronic
900314311 1:2049586-2049608 CTGGGTGTCCACCTGGTGCCTGG + Intergenic
900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG + Intronic
901679775 1:10906287-10906309 CTGGGCACCCACTTGGTGCCAGG - Intergenic
904362962 1:29990417-29990439 TTGGGTTATCACTTCTTGCAGGG + Intergenic
906396471 1:45470740-45470762 TTGGGTAGCCACTAGGTGCAAGG + Intronic
910463357 1:87471162-87471184 CTGTGTTACCACTTGGAGAAGGG + Intergenic
911064264 1:93773652-93773674 CTGGATTTCCACATGGTGCTGGG + Intronic
912405135 1:109431319-109431341 CTGGGTCACCACCTTGTGCTAGG - Intergenic
912458467 1:109815619-109815641 CTGGTGTACCACCTGGTGCCAGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
922128406 1:222752526-222752548 CTGGGTCTCCAGTTGGTGAATGG + Intergenic
922222343 1:223618331-223618353 CTGGGTCCTCACCTGGTGCAAGG - Intronic
923838041 1:237636325-237636347 CTGGGTAGACACTTAGTGCATGG + Intronic
1065869005 10:29940207-29940229 CTTGGTTACTTCTTGGTTCATGG - Intergenic
1070691887 10:78533153-78533175 CCGGGATTCCACTTGGAGCATGG + Intergenic
1071229164 10:83564924-83564946 CTGGTTTAACAGTTGGTGAACGG + Intergenic
1071307795 10:84314397-84314419 CTGAGTTGCCTCTTGGTGCAGGG - Intergenic
1082726514 11:56743379-56743401 ATGGGTTACAAATTGCTGCATGG + Exonic
1085250001 11:75136824-75136846 CTGGCTTTGCACTGGGTGCATGG + Intronic
1089604137 11:119631897-119631919 CTGGGCTACCACTTTGTGCCAGG - Intronic
1090012325 11:123056324-123056346 CTGGGTGACCACTTGGACCCAGG + Intergenic
1092908302 12:13122512-13122534 CTGTGTCACCACATGGTGGAAGG + Intronic
1093149209 12:15601827-15601849 CTGAATCACCACTTGGGGCAGGG + Intergenic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1104470788 12:129028138-129028160 CTGGGCACCAACTTGGTGCAAGG - Intergenic
1107210066 13:37842629-37842651 CTGTGTTCCCACATGGTGAAAGG + Intronic
1107911987 13:45114145-45114167 CTGAGTTATCACTTGGTAGATGG + Intergenic
1108246032 13:48515196-48515218 CTAGGTTACCTGTTGTTGCAAGG + Exonic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1112719766 13:102230149-102230171 CTGTGTTCTCACATGGTGCAAGG - Intronic
1115306747 14:31941576-31941598 CTGGGATACCATATGGTGCCTGG - Intergenic
1118177567 14:63456883-63456905 CTGTGTTAATTCTTGGTGCATGG - Intronic
1121314852 14:92954878-92954900 CTGGGATACCACTGGGTGAGGGG - Intronic
1122371422 14:101230771-101230793 CTAGGTGACCACTAGGTCCAAGG + Intergenic
1124096006 15:26649339-26649361 CTGGGTCATCACATGGTGGAGGG - Intronic
1129055721 15:72818687-72818709 GTGGGTGACCACTTGCAGCAGGG - Intergenic
1133532409 16:6667246-6667268 CTGGGTTACCACTGTGTCCATGG - Intronic
1134239659 16:12496216-12496238 CTGTGTCACAACTTTGTGCAAGG - Intronic
1134509883 16:14837486-14837508 CTGGGTTAACACTTCGTGTCTGG + Intronic
1134697531 16:16235985-16236007 CTGGGTTAACACTTCGTGTCTGG + Intronic
1134974312 16:18558690-18558712 CTGGGTTAACACTTCGTGTCTGG - Intronic
1135097637 16:19577788-19577810 CTGTGTTTTCACTTGGTGGAAGG - Intronic
1136050512 16:27646821-27646843 CTGGGTGACCTCATGGAGCAAGG - Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141027848 16:80564739-80564761 CTCTGTTACCACCTGCTGCATGG - Intergenic
1141622696 16:85245403-85245425 CTGCGTTTCCACCTGGTCCAGGG + Intergenic
1145302880 17:21653362-21653384 CTGGGTGTCCACTTGGAGCGTGG - Intergenic
1145949166 17:28802490-28802512 TTGGGTTACCACCTGGTTGATGG - Intronic
1148054586 17:44786629-44786651 CTGGGCCACCACTGGGTGCAGGG + Intergenic
1151217769 17:72589490-72589512 CTGGGTTCCCACTTTTTACAAGG + Intergenic
1152995526 18:402811-402833 CTGAGTTACCACTTTGGGGAAGG + Intronic
1161262924 19:3347472-3347494 CTGGGTTGACACTGGGTGCTGGG - Intergenic
1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG + Intronic
1162043272 19:7983224-7983246 CTGGGTTCTCACTTTGTCCAGGG - Intronic
1162717846 19:12645110-12645132 CTGTGGTCCCACTTGGGGCATGG - Intronic
1164565884 19:29325657-29325679 CTGTGTTTTCACTTGGTGCCAGG - Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165342413 19:35222546-35222568 CTGGGTGTCTACTTGGTGGACGG - Intergenic
1167016482 19:46844267-46844289 CAGGGTAATCTCTTGGTGCAGGG - Intronic
1167317037 19:48770275-48770297 CTGTGTTTCCACTTGGTGAAAGG - Intergenic
1167735075 19:51289408-51289430 CTGTGTCCCCACTTGGTGGAAGG + Intergenic
926037656 2:9647770-9647792 CTGCTTTACCACATAGTGCAAGG - Intergenic
928133538 2:28670933-28670955 CTGAGTTAGCACTGAGTGCAAGG + Intergenic
941255939 2:163231029-163231051 TTGGGTCACCACTTTGTGCCAGG + Intergenic
945447886 2:209959724-209959746 CTGTGTTCACACTTGGGGCAGGG - Intronic
947048423 2:226015149-226015171 TTGGTTTACCTCTTGGTTCATGG - Intergenic
947208877 2:227687450-227687472 CTGGATTCTCACTTGGAGCAGGG + Exonic
1168970427 20:1927102-1927124 CTGGGTTAACGCTTGCTGCCTGG - Intronic
1172003041 20:31795558-31795580 CCGGGTGATCACTTGGAGCAGGG - Intronic
1173980678 20:47221549-47221571 CTTGGGTGCCACTGGGTGCAGGG - Intronic
1174650223 20:52118631-52118653 TTGGGTTGCCACTGGGGGCAAGG + Intronic
1175671968 20:60911084-60911106 CTGAGCTATTACTTGGTGCAAGG - Intergenic
1178691635 21:34754877-34754899 ATGGTTTCCCACTTGCTGCAGGG + Intergenic
1179995055 21:44970429-44970451 CTGGGTTACCTGTTGGTGCTCGG - Intronic
1180352977 22:11819099-11819121 CTGGGGGACCCCTGGGTGCATGG - Intergenic
1180385267 22:12173258-12173280 CTGGGGGACCCCTGGGTGCATGG + Intergenic
1181871890 22:25905985-25906007 CTGGGGGACCACTTAGTGCTCGG + Intronic
1182351323 22:29701643-29701665 GTGAGTCACCACTTGGTACACGG + Intergenic
1183036291 22:35143269-35143291 CTGAGTCACCACTTGGAGGAGGG + Intergenic
1184235669 22:43181854-43181876 GTGGGTGACCACGTGATGCAGGG + Intronic
1184451343 22:44584502-44584524 GTGGGCTGCCACTTGGTGCCAGG - Intergenic
949527004 3:4914979-4915001 CTGTGTTGTCACTTGGTGGAAGG + Intergenic
954645538 3:52129435-52129457 CAGGGTATCCACTTGGGGCAGGG + Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
965365129 3:167788647-167788669 CTGGGTTACCAACTGGTGAGCGG - Intronic
967233039 3:187358975-187358997 CTGGGCTACCACTTGGGAGAGGG + Intergenic
971255703 4:25011502-25011524 CTGGGAAGCCACTTGGTGCTTGG + Intronic
976453901 4:85223505-85223527 GTGGGTTCCCTTTTGGTGCAGGG + Intergenic
978336933 4:107679207-107679229 GTGGCTTATCACTTGGTGCTAGG - Intronic
981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG + Intronic
985768400 5:1794145-1794167 CTTGGTTACCATTTGTTGCAGGG + Intergenic
993602222 5:89941356-89941378 CTGGTCCACCCCTTGGTGCATGG + Intergenic
994127704 5:96187706-96187728 CTGAGTGCCCACTTTGTGCAAGG - Intergenic
997119173 5:131156634-131156656 TTGGGTTCCCACATGGTGAAAGG + Intergenic
997922930 5:137999802-137999824 CTGTGTTACCACTGAGTGAAAGG + Intronic
999527895 5:152428029-152428051 CTGTCTTGCCACTGGGTGCAGGG - Intronic
1000284534 5:159815719-159815741 CTGTGTCATCACTTGGTGGAAGG - Intergenic
1000576063 5:162976404-162976426 CTGCATTACAACTTGGGGCAGGG - Intergenic
1001513609 5:172339767-172339789 CTGGGTCACCTCGTGGGGCAGGG + Exonic
1003833461 6:10040817-10040839 CTGTGTCCTCACTTGGTGCAAGG + Intronic
1004769582 6:18766964-18766986 CAGGGTTAACTCTTGGTCCATGG + Intergenic
1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG + Intergenic
1007729045 6:43934733-43934755 CTTGGTCAGTACTTGGTGCATGG - Intergenic
1008438096 6:51499573-51499595 CTGTGTTCTCACTTGGTGGAAGG + Intergenic
1011214024 6:84985855-84985877 CTGGGCTGTCACTTGGTGGAGGG + Intergenic
1014532925 6:122580951-122580973 CTGTGCTACCACTAGGTGGATGG + Intronic
1015402272 6:132799866-132799888 CTGAGTTACCACTTTGTGCCAGG + Intergenic
1016827032 6:148397973-148397995 CTGGGTTACCACTTCCTCTAAGG - Intronic
1018334791 6:162775135-162775157 CTGGGTCCCCACATGGTGGAAGG - Intronic
1019792914 7:3028991-3029013 CTGGGTTTCCACAGGCTGCAGGG + Intronic
1021963795 7:25897691-25897713 CCAGCTTACCACATGGTGCAGGG + Intergenic
1022319677 7:29277020-29277042 GTGGGTTACCACATGTTGCCAGG + Intronic
1023047414 7:36222740-36222762 CGGGGTCCCCACTTGGTGGAAGG + Intronic
1023224304 7:37952861-37952883 CTGGGTCACCTCTTGGTGGCAGG + Intronic
1033308179 7:140239901-140239923 CTGGGTGATCCCTGGGTGCAGGG - Intergenic
1038441891 8:27576419-27576441 CTTAGTAACCACTTGGTGCTAGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1049076092 8:140397207-140397229 CTGGGTTACCACTGTGTCAAAGG + Intronic
1058271827 9:102982018-102982040 CTGGGTCCTCACTTGGTGGAAGG - Intergenic
1060371047 9:123071857-123071879 CTGGGGAAACACTTGGTGTATGG + Intronic
1060700785 9:125747499-125747521 CTGGCTGGCCACTCGGTGCAGGG + Exonic
1061175663 9:128994978-128995000 GTGGCCTACCACTGGGTGCATGG + Intronic
1061881280 9:133570472-133570494 CTGGTGTACCACTTGAAGCAGGG - Exonic
1062725985 9:138073846-138073868 CTGGGGCATCACTTGGTGGAGGG + Intronic
1187396283 X:18922316-18922338 TTCAGTTACCACCTGGTGCATGG - Intronic
1198887281 X:141353375-141353397 CGTGTTTACCACTTGGGGCAGGG + Intergenic