ID: 1139982737

View in Genome Browser
Species Human (GRCh38)
Location 16:70872795-70872817
Sequence CTGCATGGATGGATGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3218
Summary {0: 1, 1: 11, 2: 267, 3: 893, 4: 2046}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139982737 Original CRISPR CTGCATGGATGGATGGATGA TGG (reversed) Intronic
Too many off-targets to display for this crispr