ID: 1139983410

View in Genome Browser
Species Human (GRCh38)
Location 16:70878844-70878866
Sequence TGATGTATTGTGCTCTACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 2, 1: 0, 2: 1, 3: 7, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139983410 Original CRISPR TGATGTATTGTGCTCTACAA GGG (reversed) Intronic
903411818 1:23150936-23150958 CGATTTGTTGTGTTCTACAAAGG + Intronic
904250391 1:29219535-29219557 TGATGTATAATTCTGTACAATGG - Intronic
904258446 1:29272475-29272497 TCTTGTATTGTGCTGTACATGGG + Intronic
907948226 1:59155304-59155326 GGAGGTACTGTCCTCTACAAGGG + Intergenic
909670027 1:78177871-78177893 TATTTTATTGTGCTCTACAAGGG + Intergenic
911311658 1:96300378-96300400 TGAGGTATAGTGCTCTAGAGAGG + Intergenic
911561325 1:99409551-99409573 TGATGTTATGTGCACTACAGAGG - Intergenic
912011809 1:104975712-104975734 TCATTTAATTTGCTCTACAAGGG + Intergenic
914350626 1:146836695-146836717 TGATGTATTGTGCTCTACAAGGG + Intergenic
918468325 1:184844715-184844737 GGATGTATTGTCCTAGACAAGGG - Intronic
1068416375 10:56728585-56728607 TGCTGTATTGAGCTATAAAATGG - Intergenic
1068881271 10:62051662-62051684 TGAAGTATTTTGCACGACAAAGG + Intronic
1072667824 10:97407282-97407304 TGTAGTATTGTGCTTTACAGAGG + Intronic
1074007178 10:109438974-109438996 TTGAGTGTTGTGCTCTACAAGGG + Intergenic
1074846091 10:117399345-117399367 TGTTGTATTGTGCTCATAAATGG - Intergenic
1082127000 11:48445113-48445135 TGATGTTTTATAATCTACAATGG + Intergenic
1083061783 11:59880620-59880642 TGAAGTATTCTCCTCCACAATGG - Intergenic
1086272521 11:85084062-85084084 TTATGGATTTTGCTCTAAAAAGG + Intronic
1090120340 11:124020403-124020425 TGTTGTTTTGTGCTCATCAAGGG + Intergenic
1091967353 12:4755692-4755714 TGAATTTTTGTGCTCTATAAGGG + Intronic
1093062543 12:14622769-14622791 TGATTGATTCTGCTTTACAAAGG - Intronic
1099148568 12:79078759-79078781 TGATGTATTCTTCTCTTAAAAGG - Intronic
1106387645 13:29302965-29302987 TGCTGTTTTGTGCTCTTCACTGG + Intronic
1111003627 13:82218357-82218379 TGATGTAATGTTAACTACAAAGG + Intergenic
1112320013 13:98397135-98397157 TCATGAATTGTGATCTACTAGGG + Intronic
1114978148 14:28127510-28127532 TGAAGTATGGGGCCCTACAATGG + Intergenic
1118569820 14:67183213-67183235 TCATGTATTAAGCTCCACAAAGG + Intergenic
1121987190 14:98518480-98518502 TGATGTATTCATCTGTACAACGG + Intergenic
1126889888 15:53193166-53193188 TGCTGTATTGTGTTCTGCTATGG - Intergenic
1128094207 15:64941638-64941660 TCATGTATTGAGCTATAAAAGGG - Intronic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1131603485 15:93875281-93875303 TGAAATATTCTGCTCTAAAAAGG - Intergenic
1135881648 16:26263453-26263475 TGCTGTCTTGTCCTCTCCAAGGG - Intergenic
1139983410 16:70878844-70878866 TGATGTATTGTGCTCTACAAGGG - Intronic
1146367675 17:32241904-32241926 TGCTGGACTGTCCTCTACAAGGG - Intronic
1148565259 17:48628837-48628859 TGATGGCTTGTGCTCTACAAGGG + Intronic
1149381270 17:56096287-56096309 TATTGTCCTGTGCTCTACAATGG + Intergenic
1150468207 17:65413459-65413481 TGATATATTTTGCTCTACACAGG + Intergenic
1152058967 17:78054529-78054551 TGATGTACAGTGCTCTGCAGTGG - Intronic
1154510388 18:15094189-15094211 TGATGTATTTTATTCCACAAGGG - Intergenic
1156023544 18:32626470-32626492 TGATGAATTATTCTCTAGAATGG + Intergenic
1166051495 19:40263410-40263432 TGATGTTGTCAGCTCTACAAGGG - Intronic
1167966847 19:53154868-53154890 TAGTGTATTGTGCTCTTAAACGG + Intronic
930514255 2:52386346-52386368 TCATGTCTTGTGGTATACAATGG + Intergenic
938505604 2:131878638-131878660 TGATGTATTTTATTCCACAAGGG - Intergenic
939484576 2:142794640-142794662 TGATGTCTTCTGCACTGCAATGG + Intergenic
941609279 2:167640924-167640946 TTATATATTGAGCTCAACAATGG + Intergenic
941813918 2:169781695-169781717 TGTTGCATTGTGATATACAATGG - Intergenic
946143378 2:217710768-217710790 TGATTTATTGTTCTATAAAATGG - Intronic
1169807428 20:9573883-9573905 TGTTTTATTGTGCTCTGAAAAGG - Intronic
1172825512 20:37780114-37780136 TTATGAATTGTGCCCTACAGAGG + Intronic
1173215013 20:41072964-41072986 TGATTAATTGTGACCTACAAAGG + Intronic
1176787479 21:13275213-13275235 TGATGTATTTTATTCCACAAGGG + Intergenic
1177282246 21:18995817-18995839 TGATGCATTGTGATCTTCACAGG - Intergenic
1177986643 21:27983713-27983735 TGATGTATTTTATTCCACAAGGG + Intergenic
1178742331 21:35213598-35213620 TGATGTCTTGTGCTACTCAATGG + Intronic
1182356718 22:29725538-29725560 CGCTGGATTGTGCACTACAAGGG - Intronic
1182634695 22:31716243-31716265 TAATATATTGGGCTCTACAGGGG + Exonic
957942639 3:87024325-87024347 TTATGTATTGTGCATTTCAAAGG + Intergenic
961341417 3:126224173-126224195 TGTTGTATTGTTTTCCACAATGG - Intergenic
962681585 3:137806122-137806144 TTCTGTATTGTGATCTACAATGG - Intergenic
963861735 3:150317647-150317669 TGTGCTGTTGTGCTCTACAAAGG - Intergenic
965153186 3:165009729-165009751 TGTTTCATTGTGCTCCACAAAGG - Intronic
972982418 4:44722254-44722276 TTATGTAAAGTGTTCTACAATGG - Intronic
975285296 4:72610650-72610672 TGGTGCATTGTTCTCTACCAGGG - Intergenic
976854487 4:89587327-89587349 TGATGTGTTGTGGTTTATAACGG + Intergenic
979655021 4:123182154-123182176 TAATGTTTTGTGCTTTATAACGG - Intronic
981841814 4:149121625-149121647 TCATCTATAGAGCTCTACAAAGG - Intergenic
983376117 4:166930574-166930596 TGATGTATTGTCCTCATGAAAGG - Intronic
983513660 4:168634992-168635014 TTATCTGTTGTGCTCTTCAAGGG + Intronic
984669952 4:182471778-182471800 TGATGTACTGTGCTATCCTAAGG - Intronic
986697587 5:10372163-10372185 TGATGTTTTCTGCTCCATAATGG + Intronic
994246300 5:97481647-97481669 TGATCTATTGTCTTCCACAAGGG - Intergenic
995850203 5:116536905-116536927 TGTTCTTTTGTGCTGTACAAAGG + Intronic
999864925 5:155690727-155690749 TCCTGAATTCTGCTCTACAAAGG + Intergenic
1002474921 5:179459492-179459514 TTATGTATTGTATTATACAAGGG - Intergenic
1007600599 6:43078351-43078373 GGATGTCTTGTGCTCAACAAAGG + Intronic
1008967176 6:57324349-57324371 TGATGTGTTGTGCTAAACATAGG + Intronic
1009943366 6:70315688-70315710 AAATGTAAAGTGCTCTACAAAGG + Intergenic
1011892760 6:92187391-92187413 TGATGTCTTGTACTATACAATGG - Intergenic
1012750523 6:103156915-103156937 TGATGAATTGTGATTTACAATGG + Intergenic
1021359492 7:19693025-19693047 TGTTGTCTTCTGCTCTAGAAGGG - Intergenic
1021962367 7:25885579-25885601 TGATGAATTGTGTTTTAAAAAGG - Intergenic
1026243315 7:68596159-68596181 TAATGAATTTTGCTCTACGAAGG + Intergenic
1031798199 7:126205816-126205838 TTATGTATTTTACTCTACTATGG - Intergenic
1044865749 8:96569407-96569429 TGGTGTACTGTACTCTACACTGG - Intronic
1047092780 8:121591968-121591990 TGATCTATCTTGCTCCACAAAGG + Intergenic
1048984685 8:139729058-139729080 TGATCTATTGTGCTTTTGAAAGG + Intergenic
1055189621 9:73501583-73501605 TAATGTATTTTGATCAACAAAGG + Intergenic
1059744976 9:117191553-117191575 TGATGAATTTAGCTCTACAGTGG + Intronic
1186665890 X:11716849-11716871 GCATGTATTATGCACTACAAGGG - Intergenic
1186703757 X:12120020-12120042 GAATGAATTGTGCTCTCCAAGGG + Intergenic
1187457918 X:19459104-19459126 TGATGTATGGTGGTAAACAAAGG + Intronic
1188613733 X:32131812-32131834 TGAAGTATAGTGCTCTACACTGG + Intronic
1191023732 X:55890666-55890688 TAATGTATTTTGCTCTTCTATGG + Intergenic
1194483654 X:94458563-94458585 TGATGTATTTTTTTCTATAAAGG - Intergenic
1194739486 X:97555982-97556004 TGAAGTGTTGTGCCCTAAAATGG - Intronic
1197903408 X:131397363-131397385 TGATTCATTGTTCTTTACAAAGG + Intronic
1198855125 X:141007683-141007705 TGATGCAATATGCTCTTCAAGGG - Intergenic
1198876888 X:141237457-141237479 TGATGCAATATGCTCTTCAAGGG + Intergenic
1198907566 X:141579686-141579708 TGATGCAATATGCTCTTCAAGGG + Intergenic
1198909225 X:141594738-141594760 TGATGCAATATGCTCTTCAAGGG - Intronic
1198917852 X:141693413-141693435 TGATGCAATATGCTCTTCAAGGG + Intronic