ID: 1139988714

View in Genome Browser
Species Human (GRCh38)
Location 16:70921500-70921522
Sequence CTGCTGTTCTGCAGGATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 2, 1: 0, 2: 1, 3: 21, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139988714 Original CRISPR CTGCTGTTCTGCAGGATCAA GGG Intronic
900762679 1:4483470-4483492 CTGCTGGTCTCCAGGCCCAAGGG - Intergenic
900810313 1:4796840-4796862 CTGCTGTACTGCAGGAGGGAAGG + Intergenic
902500351 1:16907006-16907028 CAGCAGTTCTGCAGGACCACAGG + Intronic
905980236 1:42218913-42218935 CTGCTGTCCTGCAAGTGCAAGGG - Intronic
906076013 1:43052659-43052681 CTGCAGCTTTGGAGGATCAAAGG - Intergenic
908817211 1:68046882-68046904 GAGCTGATCTGCAAGATCAAAGG - Exonic
910627009 1:89317427-89317449 CTGCTGTTCTTCAGCCCCAATGG + Intergenic
912007011 1:104916867-104916889 TTGCTGTTCTGCAGCCTCACTGG - Intergenic
912312225 1:108634217-108634239 CTGATTTTCTGTAGGATGAATGG + Intronic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
914932305 1:151946029-151946051 CTGATGTACTGCAGGAACCAAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
921697197 1:218225284-218225306 ATGCTGGTCTGCAGTATCACTGG - Intergenic
923104218 1:230842169-230842191 CTTTAGTTCTGCAGGATGAAAGG + Intronic
924094740 1:240539509-240539531 CTGATGTTCTGAATGATCAGAGG - Intronic
1062837666 10:646495-646517 CTGCCGGCCTGCAGGATCACAGG + Intronic
1064190904 10:13204745-13204767 CTGCTGTTCTTCAGTATCCAAGG + Intronic
1068413468 10:56687120-56687142 TTGTATTTCTGCAGGATCAATGG - Intergenic
1069264733 10:66443522-66443544 CTGCTGTTCTGCAGCCACCACGG + Intronic
1069678611 10:70267515-70267537 CAGCTGTGCTGCAGCATCATTGG - Intronic
1070108875 10:73463013-73463035 CTGCTGTTCTTCATGTTCATTGG - Intronic
1070681376 10:78451623-78451645 CTGCTGCTCTGCAGGGCCCAGGG + Intergenic
1071483662 10:86083381-86083403 CTGCTGTTCTACAGCAGCACAGG - Intronic
1071949299 10:90684612-90684634 CTGCTGTTATGCAGTACAAAGGG - Intergenic
1073304539 10:102492625-102492647 CTGCTCTTCTGCAGGAAGAGGGG + Intronic
1074225468 10:111480044-111480066 CTGCTTTTCTGCAGGCACAATGG + Intergenic
1077938676 11:6817176-6817198 CTGCTGTCCTGCAGGTACATAGG - Intergenic
1081137738 11:39459938-39459960 CTGCTGTTGTGGAGAACCAATGG - Intergenic
1082771925 11:57214441-57214463 GTCCTGTTGAGCAGGATCAATGG - Intergenic
1084185092 11:67467353-67467375 CGGCGGTTCTTCTGGATCAAAGG + Exonic
1087920574 11:103862250-103862272 CTGCTGGTCTGCAGAATCCAAGG - Intergenic
1088294379 11:108276685-108276707 TTGCTGTTCTGCAGCCTCCATGG - Intronic
1088917140 11:114236085-114236107 CTGCTGTTCTGAAGAATGAATGG - Intronic
1088976128 11:114817923-114817945 CTGCTGTCCTGCATGAACAGGGG + Intergenic
1090539317 11:127683089-127683111 GTTGTGTTCTGCAGGATAAATGG - Intergenic
1090729213 11:129555279-129555301 CTACTGTTCTGCGGGCTCAGAGG - Intergenic
1091800739 12:3323162-3323184 CTGGTGTTCTCCAGGATCTTAGG - Intergenic
1091864294 12:3817805-3817827 CTGATGTTCAGCAGGATGACAGG - Intronic
1092107287 12:5930778-5930800 GTGCTGTTCTGCAGGACCTCTGG - Intronic
1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG + Intronic
1093996118 12:25644704-25644726 CTTCTATTCTGCAGCATCTATGG - Intronic
1096392510 12:51240010-51240032 CTGCTGTTCTGGCTTATCAAGGG - Intronic
1097776199 12:63649500-63649522 TTGCTTTTCTACAGGGTCAATGG - Intronic
1101772259 12:107761802-107761824 CTGCTGTTCTGCTGGTGTAAGGG - Intergenic
1103377062 12:120465241-120465263 CTGATCTTCTTCAGGATCCAAGG + Intronic
1103891498 12:124242378-124242400 TTGCTGCTCTGCAGAAACAATGG + Intronic
1108934834 13:55871057-55871079 CTGCTGTTCACCAGGTTCCAGGG + Intergenic
1111041523 13:82756135-82756157 CTCCTTCTCTGCAGGATCAGAGG - Intergenic
1111305695 13:86409896-86409918 CTGCTGGTCTGCAGAGTCTATGG - Intergenic
1113117695 13:106891011-106891033 CTTCTTTTTTGCAGGATGAAGGG + Intergenic
1114268152 14:21084855-21084877 CTCCTGTTCAGCAAGCTCAAGGG + Exonic
1114843201 14:26290335-26290357 CTGCAGTTCTTCAGTATCCATGG + Intergenic
1114876193 14:26721674-26721696 TTGCTGTTCTGTAGGAATAAAGG + Intergenic
1115455181 14:33593805-33593827 CTACTATTCTGCAACATCAAGGG - Intronic
1116835686 14:49767693-49767715 CTGCTGTTCTGCGGGCGCGAGGG - Exonic
1117270740 14:54140785-54140807 CTTCTGATCTGCAGGAACTATGG + Intergenic
1118077348 14:62314531-62314553 CGTCTGTTCTTCAGGATCATGGG - Intergenic
1120221573 14:81740368-81740390 CTGCTGTTCTTCACTTTCAACGG - Intergenic
1121172881 14:91869127-91869149 TTCCTGTTCTGCAGGAGCACCGG + Intergenic
1122823543 14:104358990-104359012 CTGCTGTTCTGAGGGCTCAGCGG + Intergenic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1123117427 14:105900979-105901001 CTGCATTTCTGCAAGATCAGGGG - Intergenic
1125112917 15:36054290-36054312 CTACTGCTCTACAGGGTCAAAGG - Intergenic
1125468243 15:39976477-39976499 CGGCAGTTCCGCAGGATCAAGGG + Exonic
1127272008 15:57409981-57410003 CTTCTGTTCTGGAAGATTAAAGG + Intronic
1129540370 15:76342936-76342958 CTGCTGTGCTGCAGGGCCAGGGG - Intergenic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1130398796 15:83529925-83529947 CTGCTGTGCTGCTGAAACAAGGG - Intronic
1135429066 16:22366778-22366800 CTGCTGTTATACAGGGTGAATGG + Intronic
1137580723 16:49632102-49632124 GTGGGGATCTGCAGGATCAATGG + Intronic
1137637495 16:49999592-49999614 CCTCTGTTCTGCAGGCTCACTGG - Intergenic
1138600629 16:58051883-58051905 CTGTTCTTCTGCAGAACCAAGGG + Intergenic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1141149340 16:81553229-81553251 CTGCTTTTCTGGAAGATGAAGGG + Intronic
1141545655 16:84766476-84766498 CTGCTGGGCTGAAGGAGCAAAGG - Intronic
1141798484 16:86290986-86291008 CTGCAGTTCTGCACCACCAATGG + Intergenic
1141952696 16:87348854-87348876 CAGTTGTTCTGCGGGATCCAGGG - Intronic
1203142819 16_KI270728v1_random:1779783-1779805 CTGATGACCTGCAGGAACAACGG + Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1145016679 17:19403272-19403294 CTGCTGTCCTGCTGAACCAATGG - Intergenic
1145987865 17:29059609-29059631 TTTCAGTTCTGCAGGATGAAAGG + Intergenic
1146076779 17:29737824-29737846 TTACTGTTCTGTAAGATCAAAGG - Intronic
1147977698 17:44257528-44257550 CTGCAGTTCTGCGAGACCAACGG - Exonic
1148186980 17:45651238-45651260 CTGCAGTGCTCCAGGATCACGGG + Intergenic
1152997761 18:424228-424250 CTTCTGTAATGCAGGATCCATGG - Intronic
1153789491 18:8564854-8564876 CTGCTGTTCAGTAGCTTCAAAGG - Intergenic
1154365146 18:13701185-13701207 CAGCTGCTCTGAGGGATCAAAGG - Intronic
1154463658 18:14621560-14621582 CTGCTGTTCAGAAGAAACAAGGG - Intergenic
1156907455 18:42370841-42370863 CTGCTCCTCTGAAGCATCAATGG + Intergenic
1157561310 18:48648385-48648407 CTGCTGTTCTCCTGCTTCAAAGG + Intronic
1160100386 18:75915365-75915387 CTGCTTTACTGCAGGATGATAGG - Intergenic
1160448166 18:78943177-78943199 CTGCAGAACTGCAGGATCAAAGG - Intergenic
1161338190 19:3725931-3725953 CTGCAGTTCTGAAGGAGCCAGGG - Intronic
1163328899 19:16623421-16623443 CTGCTTTTCTGCAGAATAAATGG + Intronic
1164927549 19:32142084-32142106 CTGCTGTGCTGCAGCCTCAAAGG + Intergenic
1166591012 19:43998480-43998502 CTACTGTTCTGCAGCACTAAAGG - Intergenic
1166597948 19:44067454-44067476 CTGCTGTTCTGCAGCACTAAAGG - Exonic
1166872229 19:45877638-45877660 CCGCTGTTCTGCAGGATGGGAGG + Intergenic
925088745 2:1135265-1135287 CTGCTGTTCTGTAGGATCTCAGG + Intronic
925306934 2:2854451-2854473 CTGATGTACTGAAGGAACAAAGG + Intergenic
925342141 2:3145224-3145246 GGGCTGTTCTACAGGATCAAGGG - Intergenic
925996962 2:9301363-9301385 CTGCGGTGATGCAGGATGAAAGG + Intronic
926234563 2:11029531-11029553 CTTCTGTTCTGCAGAACCAGAGG + Intergenic
929405562 2:41637421-41637443 CTGCTGGTCTGCAGAGACAATGG - Intergenic
929584728 2:43106456-43106478 CTTCTGTTTTGCAGGATGAGGGG + Intergenic
930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG + Intergenic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
932716892 2:74107219-74107241 CTGCAGCTCTGCAGGAGGAAGGG - Exonic
933405049 2:81847378-81847400 CTTCTGTTTTTCAGGATCACAGG - Intergenic
934056088 2:88252813-88252835 CTTCTGTTCTGCAGTAACACAGG - Intergenic
936771862 2:115923204-115923226 TTGCTGTTTTCCAGGATCACAGG + Intergenic
938307206 2:130264318-130264340 CTGCTGTACTGCCGGGCCAAGGG + Intergenic
941447629 2:165622533-165622555 CTGCTGCTGTGAAGGCTCAATGG + Intronic
941541261 2:166788067-166788089 CTGCTTTTCAGCAGGAACACTGG - Intergenic
942663992 2:178296929-178296951 CTGCTATTCTGGAGGATGACAGG + Intronic
945911171 2:215651321-215651343 CTGCTGTTCTACCAGCTCAACGG + Intergenic
946113934 2:217445494-217445516 CTGTTGTCCTGCTGGATGAAAGG - Intronic
948472628 2:238194323-238194345 CTGCTGTGTTTCAGGATCAGGGG - Exonic
1168997463 20:2143996-2144018 CTGCTCTTCTGAAGTCTCAATGG - Exonic
1173464687 20:43271582-43271604 CTGCTGTCCTGCAGAAGGAAGGG + Intergenic
1177805389 21:25869955-25869977 CTGGTGTTCTGAAGGATGAATGG + Intergenic
1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG + Intergenic
1178296168 21:31412342-31412364 CTGCTGTTATGGAGTACCAATGG - Intronic
1178698058 21:34810973-34810995 CTGCTGCTCTGCAGGAGGAAGGG - Intronic
1179460297 21:41530069-41530091 CTGCTGAGCTGTAGGACCAAAGG - Intronic
1182094837 22:27619130-27619152 CTGCTGGTCTGCAGGACACAAGG + Intergenic
1182950728 22:34373168-34373190 CTGATGATCTGCAGGATCCCAGG - Intergenic
1184633610 22:45806980-45807002 TTGCAGTTGTCCAGGATCAACGG - Exonic
1184950439 22:47838264-47838286 CTGCTGTTCAACATGACCAAGGG - Intergenic
949117492 3:345291-345313 CTGCTGCTTTGCAGGTTCCAAGG + Intronic
950297946 3:11848116-11848138 CTGCTGCCCTGCAGGAGCTAGGG + Intergenic
952711948 3:36440406-36440428 CTGCTGTCCTGCAGGCATAAGGG - Intronic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
954852231 3:53613008-53613030 ATGCAGTTCTGTAGGATTAAAGG + Intronic
955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG + Intronic
958969385 3:100594646-100594668 CTGATGTTCTGCAACATAAAGGG + Intergenic
960979653 3:123211059-123211081 AAGCTGTGCTGCAGGTTCAAGGG + Intronic
961051457 3:123750590-123750612 CTGTCTTTCTGCAGGATAAAGGG - Intronic
961510199 3:127396150-127396172 CTGCTCTTGTGGAGGATGAAGGG + Intergenic
962348411 3:134639403-134639425 CTGCTGGTGTGCATGATGAAGGG + Intronic
962474204 3:135741341-135741363 CTGCTGCTCTGCAGAATGAATGG - Intergenic
962679723 3:137785679-137785701 TGGCTGTTCTGGAAGATCAAAGG - Intergenic
962680260 3:137792018-137792040 CTTCTGTTCTGCAGGTACACAGG + Intergenic
964473991 3:157082473-157082495 GTGCTGTGCTGCAGGAGCAAAGG + Intergenic
964555409 3:157931742-157931764 CTACTGGTCTGCAGCATGAACGG - Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
970200403 4:13599229-13599251 CTGCTGCTCAGCAGGAAGAAAGG + Exonic
970285392 4:14507674-14507696 CTGCTGTGCTGCAGGGCCCAAGG + Intergenic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
971041398 4:22756326-22756348 CTGCTGTTCTGCCTAATCCAAGG + Intergenic
972570552 4:40306751-40306773 ACACTGTTCTGCAAGATCAAAGG + Intergenic
973889786 4:55357394-55357416 ATGCTGTTCTGCAGGCTCCCAGG - Intronic
977953808 4:103003724-103003746 CTGCTGTGCTGCAGGAGCCAAGG - Intronic
978686086 4:111445042-111445064 CAGCTGTTTTGCAGCATGAAAGG - Intergenic
981910022 4:149968101-149968123 CAGTTTTTCTGGAGGATCAAGGG - Intergenic
983047391 4:163004041-163004063 TTGCTGTTCAGCAGCATCCATGG - Intergenic
985754797 5:1707160-1707182 CTGCTTTTCTGCAGGTTCGCTGG + Intergenic
985907341 5:2850656-2850678 TTTCTGTGCTGCAGGATAAAAGG - Intergenic
987115541 5:14723825-14723847 CTCTTATTCTGCATGATCAAGGG + Intronic
988984843 5:36607387-36607409 CAGCTGTTCTGAAAAATCAAGGG - Intronic
990249785 5:53901947-53901969 ATGCTATTTTGCAGAATCAAAGG - Intronic
990441769 5:55853521-55853543 CAGATGTTCTGCTGGCTCAAAGG - Intronic
992077960 5:73207888-73207910 TTGCTGTTCTGCAGCCTCCATGG + Intergenic
992449150 5:76859970-76859992 CTGCTGGTTTTCTGGATCAAGGG + Intronic
993048170 5:82892755-82892777 CTGGTGCTGTGCAGGACCAATGG + Intergenic
993228677 5:85204096-85204118 CTACTGTGCTGGAGGAGCAAAGG + Intergenic
993617151 5:90127197-90127219 GTGAGGTTCAGCAGGATCAAAGG - Intergenic
993661416 5:90640943-90640965 CTGCTGTTCTGCATGATTACAGG + Intronic
997145972 5:131433528-131433550 CTGCAGCTCTACAGGATGAACGG - Exonic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
999125539 5:149243378-149243400 CTGCTCCTCTGCAGCTTCAATGG - Intronic
999941071 5:156543744-156543766 CTGCAGTCTTGGAGGATCAAAGG - Intronic
1000049953 5:157554308-157554330 CTGCTCTTCAGCAGGAGCACGGG - Intronic
1001574032 5:172750178-172750200 CTGCTGGTCTGGCTGATCAAGGG + Intergenic
1001702822 5:173719930-173719952 CTTCTGTTCTGCAGGCTGAGGGG + Intergenic
1004999591 6:21227622-21227644 CTGCTTCTCTGCAGGATGCAGGG + Intronic
1005175102 6:23035774-23035796 CAGGTGTCCTGCAGGATCCAAGG + Intergenic
1005547906 6:26888154-26888176 CTGCTGCTCTGCAGGCCCAGAGG - Intergenic
1006979528 6:38135864-38135886 CTTCTGGACTGCAGGCTCAAGGG - Intronic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1007585658 6:42987672-42987694 CACCTGTTCTGCAGGAGCCAGGG + Intronic
1008644249 6:53497062-53497084 CTGCTGTTGTGCTGGGTCAGTGG - Intergenic
1012932013 6:105327276-105327298 CTGCTGTACTCCAGGTTCTAGGG + Intronic
1017375854 6:153767171-153767193 TTGCTGTTTTCCAGGAACAAAGG - Intergenic
1018032745 6:159855594-159855616 CTGGTGTTCTGCAGCAGCATAGG - Intergenic
1018482094 6:164201198-164201220 CTGATTTTCTCCAGGACCAAGGG - Intergenic
1019435448 7:1020100-1020122 CTGCTGCTCTGCGGGAACACGGG + Intronic
1022935110 7:35167094-35167116 TTGCTTTTCTACAGGGTCAATGG - Intergenic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1023684592 7:42721400-42721422 CTCTTGTTCTCCAGGATCACAGG - Intergenic
1026736130 7:72949845-72949867 CTGCTCTTCTGAAGAACCAAGGG - Exonic
1026786473 7:73304746-73304768 CTGCTCTTCTGAAGAACCAAGGG - Exonic
1027107597 7:75415213-75415235 CTGCTCTTCTGAAGAACCAAGGG + Intergenic
1027254885 7:76424946-76424968 CTGCTGCTCTGCAGGTACCATGG + Exonic
1028004271 7:85542470-85542492 CTGCTGTTCTGCAGTCTCTGCGG - Intergenic
1029831061 7:103259869-103259891 TTGCTTTTCTACAGGGTCAATGG - Intergenic
1034555824 7:151849778-151849800 CTGCAGTTATGCTGGATTAAGGG + Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1037174521 8:15931122-15931144 CTGCTCTTCTGGATGATGAAAGG + Intergenic
1037825094 8:22156147-22156169 CTGCAGTTTTGCAGGCTCAGCGG - Intronic
1038704586 8:29881655-29881677 CTGGTCTTCTGCGGGATGAATGG - Intergenic
1039301517 8:36214425-36214447 CTGCTTCTCTGCATGAGCAATGG + Intergenic
1041381298 8:57256979-57257001 CTGCAGTGATGCAGGATGAAGGG - Intergenic
1042773732 8:72405974-72405996 TTGCTGTTCTGCAGCCTCCACGG + Intergenic
1045293503 8:100853156-100853178 CTGCTGTTCTGCAGCCACCACGG + Intergenic
1045367049 8:101485925-101485947 CTGATGTTCTACAGGCTAAATGG + Intergenic
1046484053 8:114861921-114861943 TTGCTGTCCTGCAGCAGCAATGG + Intergenic
1047653810 8:126953379-126953401 GTGCTGTTATGCAGTCTCAATGG + Intergenic
1048819818 8:138370279-138370301 ATGCTGTTGTTCAGGATGAATGG + Intronic
1049814096 8:144590051-144590073 CTTGTGTTCTGCAGGATGACAGG - Intronic
1051122040 9:13761918-13761940 CTGCTGGTCTGCTGGACCACAGG - Intergenic
1051697881 9:19788782-19788804 TTGCTGCTCTGCAGGCTCACAGG - Intergenic
1052061461 9:23965984-23966006 TTGCTGTTCTGCAGCCTCCACGG - Intergenic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1053598337 9:39585755-39585777 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1053856370 9:42342764-42342786 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1057090677 9:92255305-92255327 CTGCTGTTGGGCAGGAGCAGCGG - Intronic
1061474470 9:130854965-130854987 CTGCTGAGCAGCGGGATCAATGG + Exonic
1061578398 9:131522187-131522209 CTGATGTGCTGCAGGACCACAGG - Exonic
1062450977 9:136615675-136615697 CTGCCGGCCTGCAGGACCAAAGG - Intergenic
1186207850 X:7218740-7218762 TTGCTGTTTTCCAAGATCAAAGG + Intergenic
1188918115 X:35937192-35937214 CTCCTCTTCTGCAGGATCTCAGG + Intronic
1189940065 X:46112479-46112501 TTGCTGTTCTGCAGGATCACTGG - Intergenic
1192371788 X:70520442-70520464 TTGCTGTTCTGCAGCCTCCACGG - Intergenic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1195220301 X:102739864-102739886 CTGCATTTCTGCAGCAGCAAAGG - Intronic
1195495338 X:105525252-105525274 CAGCTGCTATGAAGGATCAAAGG + Intronic
1195579569 X:106485714-106485736 CTGCTGATCTGAAAGATTAAGGG + Intergenic
1196628434 X:117906275-117906297 CTGCTATTCTGCAAAAACAATGG + Intronic
1197780715 X:130157532-130157554 CTGCTTTTATGCAGCATCAGTGG - Intronic
1198768541 X:140103751-140103773 ATGGTGTTCTGAAGGATCATCGG + Intergenic
1199637040 X:149824127-149824149 CTGCTGTTCTGCAGCCTCCTCGG - Intergenic
1201054659 Y:9976471-9976493 CTCCTGTTCTGCTGGAGGAATGG - Intergenic
1201409192 Y:13681269-13681291 TTGCTGTTCTGCAGTCTCACTGG + Intergenic
1201422207 Y:13812030-13812052 TTGCTGTTCTGCAGCCTCAGTGG - Intergenic
1201460189 Y:14213903-14213925 CTGGGGGTCTGAAGGATCAAGGG - Intergenic
1201579653 Y:15497396-15497418 TTGCTGTGTTGCAAGATCAAAGG + Intergenic
1202191724 Y:22252980-22253002 CTCCTGTTCTGCTGGAGGAATGG + Intergenic