ID: 1139991197

View in Genome Browser
Species Human (GRCh38)
Location 16:70940831-70940853
Sequence GCGGTAAGCCGGAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139991191_1139991197 25 Left 1139991191 16:70940783-70940805 CCTTAATTGGAAAAGCATTATGA 0: 2
1: 0
2: 1
3: 27
4: 216
Right 1139991197 16:70940831-70940853 GCGGTAAGCCGGAGTGAGGAAGG 0: 2
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139991197 Original CRISPR GCGGTAAGCCGGAGTGAGGA AGG Intronic
901752848 1:11422112-11422134 GTGGGAGGCAGGAGTGAGGAAGG - Intergenic
903977081 1:27157441-27157463 GAGATAAGCCAGAGGGAGGAAGG + Intronic
905312636 1:37060785-37060807 GGGGAAAGCTGGAGTCAGGATGG - Intergenic
911725890 1:101240238-101240260 GCTGCAAGCCAGAGGGAGGAAGG + Exonic
913278954 1:117166688-117166710 GAGTTAAGCCTTAGTGAGGAAGG + Intronic
914342788 1:146774497-146774519 GCGGTAAGCCGGAGTGAGGAAGG - Intergenic
916562147 1:165942207-165942229 GCGGTAAGCAGGCCTGAGAATGG - Intergenic
920504527 1:206507041-206507063 GCGACAAGCCGGAGAGAGGAAGG + Intergenic
920806623 1:209240664-209240686 GCAGTGAGTAGGAGTGAGGATGG - Intergenic
920822473 1:209393925-209393947 GCGGTCAGCCGGAGGGCAGATGG + Intergenic
1067946779 10:50694610-50694632 GAGGTGAGCCTGAGTGAGCAGGG - Intergenic
1070882089 10:79859603-79859625 GAGGTAAGCCTGAGTGAGCAGGG - Intergenic
1071648663 10:87375914-87375936 GAGGTGAGCCTGAGTGAGCAGGG - Intergenic
1071718489 10:88120131-88120153 GGGGGAAGCAGGAGCGAGGAGGG + Intergenic
1084774299 11:71365157-71365179 GAGGAAGGCTGGAGTGAGGAAGG - Intergenic
1089649915 11:119906012-119906034 GTGTTAAGCAGGGGTGAGGAGGG + Intergenic
1093369912 12:18354340-18354362 GGGGCAAGCTGGAGAGAGGACGG + Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1104223211 12:126806249-126806271 GTGGTCACCAGGAGTGAGGAAGG - Intergenic
1104862177 12:131929506-131929528 GGGGTCAGCAGGAGTGAGGCTGG + Exonic
1105426933 13:20302121-20302143 GCGGGAAGCAGGAGACAGGATGG - Intergenic
1112280712 13:98060639-98060661 GCAGTAAGCCAGAGTGAGAAAGG - Intergenic
1119474224 14:74917935-74917957 GCGGGAAGTGGGAGTGAGCAGGG + Intronic
1122324819 14:100875725-100875747 GGGGGAAGCGGGGGTGAGGAAGG - Intergenic
1125550607 15:40541726-40541748 GGGGTGAGCAGGAGTGAGGGAGG - Intronic
1126342113 15:47652455-47652477 GCGGGCAGGCGGGGTGAGGAGGG - Intronic
1127968610 15:63942188-63942210 GAGGTGAGCCTGTGTGAGGAAGG - Intronic
1133424194 16:5673444-5673466 GCTGAAAGCCAGAGAGAGGAAGG - Intergenic
1139261756 16:65600728-65600750 GCAGTAAGTGGGAGTGAGAAGGG - Intergenic
1139991197 16:70940831-70940853 GCGGTAAGCCGGAGTGAGGAAGG + Intronic
1142757667 17:2025353-2025375 GGGGGAAGCCGGGGGGAGGAAGG - Intergenic
1143502990 17:7349820-7349842 GTGGTAATCAGGAGTGTGGAAGG - Intronic
1143763817 17:9124372-9124394 GAGAGAAGCCGGAGGGAGGAGGG - Intronic
1144278791 17:13703335-13703357 GCGGGGAGAGGGAGTGAGGAAGG + Intergenic
1144747568 17:17626092-17626114 GGGGTAAGCCAGAGTGAAGAGGG - Intergenic
1147308308 17:39578657-39578679 GTGGGAAGTCGGAGAGAGGAAGG + Intergenic
1152017883 17:77763812-77763834 GCGGTAAGCCCAGGTGAGCAGGG + Intergenic
1152815516 17:82405304-82405326 CCGGTAAGGAGGAGTGAGGCGGG - Exonic
1153584340 18:6605781-6605803 GGGGTAAGCAGAACTGAGGATGG + Intergenic
1155392695 18:25352208-25352230 GCGGGGAGCGGGAGGGAGGAGGG + Intergenic
1156498824 18:37544001-37544023 GGGGGAAGCAGGAGTGAAGAGGG + Intronic
1161824126 19:6551198-6551220 GCTGAAAGCTGCAGTGAGGATGG - Intergenic
1162185574 19:8902063-8902085 GGGGTGGGGCGGAGTGAGGAGGG + Intronic
1163287425 19:16357398-16357420 GGGATAAGCCAGACTGAGGAGGG + Intronic
1163287457 19:16357534-16357556 GCGGGAAGCAGGAGAGAGGAGGG + Intronic
1164283739 19:23791597-23791619 GCTGTAAGCCAGAGTTAGGCTGG - Intronic
1165812135 19:38618019-38618041 GCAGGAAGCGAGAGTGAGGAGGG - Intronic
1167109355 19:47449856-47449878 GCGTTTACCCTGAGTGAGGAAGG + Intronic
936977088 2:118231385-118231407 GCCGGAAGCCAGAGTGCGGAGGG - Intergenic
937083402 2:119156272-119156294 GCGGTGAGTCTGAGTCAGGAGGG + Exonic
937308178 2:120884944-120884966 GGGGAAAGCAGGAGTGAGGCCGG - Intronic
938696762 2:133841767-133841789 GAGGAAAGCAGGAGTGAGGCTGG + Intergenic
947118902 2:226797596-226797618 GCGGGAAGCCGGCATGGGGATGG + Exonic
947232788 2:227904788-227904810 GCGGTTGGCTGGGGTGAGGATGG - Intronic
948372821 2:237501051-237501073 ACGGTGAGCAGGGGTGAGGAGGG - Intronic
948456280 2:238106042-238106064 GAGGAAAGCAGGAGTGAGGATGG - Intronic
948584361 2:239009680-239009702 GCGGGAAGCTGGTCTGAGGAAGG - Intergenic
1171295361 20:24012409-24012431 GCAGGAAGCGGGAGGGAGGATGG + Intergenic
1180928088 22:19570215-19570237 GAGGTAAGGCGGAGTAAGGTTGG + Intergenic
1181311923 22:21949566-21949588 GCGGCAAGCCGCAGGGAGTAGGG + Intronic
1182295582 22:29309810-29309832 GGGTGAAGCGGGAGTGAGGACGG + Intronic
1184066910 22:42126420-42126442 GGGGTAAGCAGGAATGAGGCAGG + Intergenic
1184069637 22:42140124-42140146 GGGGTAAGCAGGAATGAGGCAGG + Intergenic
1184533186 22:45070036-45070058 GCGGTAGGCCTGGGTGAAGAGGG + Intergenic
1185391062 22:50562122-50562144 GGGGTGAGGCGGGGTGAGGAGGG + Intronic
1185391182 22:50562445-50562467 GGGGTGAGGCGGGGTGAGGAGGG + Intronic
959483143 3:106897645-106897667 GTGGTAAGCCTGAGTTTGGAGGG + Intergenic
960575006 3:119220654-119220676 GGGGTGAGCTGGAGTGGGGAGGG + Intronic
964525930 3:157615331-157615353 GCGGTGAGCCAGTGTGATGAAGG - Intronic
967848603 3:194064623-194064645 GCTCTAAGCCGGAGTCAGGAGGG + Intergenic
968574366 4:1358143-1358165 CCGGCCAGCAGGAGTGAGGAAGG - Intronic
977113826 4:92995330-92995352 GTGGGAAGATGGAGTGAGGAGGG + Intronic
991037488 5:62142670-62142692 GCTGAAAGACTGAGTGAGGATGG - Intergenic
997013344 5:129904402-129904424 GCGGGAGGCGGGAGTGAGGGCGG + Intergenic
997023490 5:130029834-130029856 GCGGAAAGATGGAGTGGGGATGG - Intronic
1003020375 6:2504631-2504653 GGGGTAAGGAGGGGTGAGGAGGG - Intergenic
1007373462 6:41441826-41441848 GCGGTAAGAGGGAAAGAGGAGGG + Intergenic
1011501076 6:87990707-87990729 GTGGTAATCTGGGGTGAGGAAGG + Intergenic
1013581816 6:111542576-111542598 GCGGTGAGCAGAAGTGAGCAAGG + Intergenic
1016816354 6:148306591-148306613 GCTGTAAGTAGGAGTGTGGATGG - Intronic
1018985902 6:168636961-168636983 GAGGAAAGCAGGAGGGAGGAGGG - Intronic
1020460401 7:8423855-8423877 GCGGGAAGCTTCAGTGAGGAAGG + Intergenic
1021278400 7:18685094-18685116 GTGGTAAGCCACAGTGAGGGTGG - Intronic
1026109237 7:67445677-67445699 ACAGTCAGCAGGAGTGAGGATGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034347473 7:150396484-150396506 GAGGCAAGCGGGAGAGAGGAGGG - Intronic
1035409007 7:158623512-158623534 GTGGTGAGCCTCAGTGAGGAGGG - Intergenic
1038248223 8:25878822-25878844 GGGGGCAGTCGGAGTGAGGAGGG - Intronic
1044264883 8:90169787-90169809 CCTGTAAGCTGGAGTGATGAAGG + Intergenic
1053054718 9:34987797-34987819 GGGGTGAGGAGGAGTGAGGAAGG - Intergenic
1053209100 9:36212450-36212472 CCAGTAAGCCTGAGTCAGGACGG + Intronic
1055567138 9:77580610-77580632 GAGGTCAGCCGAAGTGAGCAGGG - Intronic
1058820722 9:108727349-108727371 GCAGTAAGCCGGAGGCAGGCAGG + Intergenic
1060114254 9:120928482-120928504 GCGGGAAGCCGGGGAAAGGAAGG - Exonic
1061257345 9:129460422-129460444 GCGGGAGGGCGGAGGGAGGAAGG - Intergenic
1187826129 X:23334584-23334606 GCGGTAGGGCGGAGTGGGGGCGG + Exonic
1194720587 X:97335964-97335986 GAGTTAAGTGGGAGTGAGGAAGG - Intronic
1198158665 X:133985990-133986012 GCGGGAAGGAGGAGTGAGGCTGG - Intergenic
1200011349 X:153123231-153123253 TTGGCAAGCCGGAGTGAAGAAGG + Intergenic
1200028250 X:153276691-153276713 TTGGCAAGCCGGAGTGAAGAAGG - Intergenic
1201937017 Y:19420337-19420359 ACTGTAAGCTGGAGTGAGCAGGG - Intergenic