ID: 1139991282

View in Genome Browser
Species Human (GRCh38)
Location 16:70941429-70941451
Sequence CAGTGTGATGGGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 2, 1: 0, 2: 5, 3: 56, 4: 572}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139991271_1139991282 15 Left 1139991271 16:70941391-70941413 CCCGTAATGGCTGTAATTGCAGA 0: 1
1: 0
2: 3
3: 12
4: 154
Right 1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG 0: 2
1: 0
2: 5
3: 56
4: 572
1139991272_1139991282 14 Left 1139991272 16:70941392-70941414 CCGTAATGGCTGTAATTGCAGAA 0: 1
1: 1
2: 1
3: 14
4: 194
Right 1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG 0: 2
1: 0
2: 5
3: 56
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139991282 Original CRISPR CAGTGTGATGGGAGGGAAGC AGG Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900678670 1:3904117-3904139 CAGTGTGATGGGAGCCACGGGGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901689547 1:10963897-10963919 GAGTGAGATGGGAGGGGAGGGGG - Intronic
901799168 1:11697554-11697576 CATTGGGATAGGAGGGAACCAGG - Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902395613 1:16130989-16131011 AAGAGAGATGGGAGGGAGGCTGG - Intronic
902667040 1:17946724-17946746 CAGAGAGATGGGAGGGATGGGGG + Intergenic
902974649 1:20080151-20080173 CAGTGTGGTGGGTGGGAGGGAGG + Intronic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
904597974 1:31658598-31658620 CAGTGAGAGGGGAGGAAAGCAGG + Intronic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905830197 1:41059511-41059533 CAGTGGGATGGATGGGGAGCTGG - Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906319029 1:44805421-44805443 CAGGGTGCTGGGGAGGAAGCTGG + Intronic
906587449 1:46991810-46991832 CATTGTGATGCGTGGGAAGGAGG + Intergenic
908896781 1:68909974-68909996 CAGTGAGATGGATGGGGAGCTGG - Intergenic
909185618 1:72481908-72481930 GAGTGAGAGGGAAGGGAAGCTGG + Intergenic
910998133 1:93131209-93131231 CAGTGAGATGGGAGGAAACCAGG + Intronic
911335435 1:96575166-96575188 CAGTGGGATGGATGGGGAGCTGG + Intergenic
912196364 1:107401804-107401826 CAGTCTGTTGGGAAGGAAACTGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913454722 1:119019303-119019325 CAGTGAGATGGATGGGGAGCTGG - Intergenic
914226278 1:145721606-145721628 CAGCGGGATGGGAGGGGCGCAGG - Intronic
914244592 1:145876309-145876331 AGGTGTGAGGGGAGGGGAGCCGG - Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
915558440 1:156673109-156673131 AAGGGTGAGGGGAGGGAAGTTGG + Exonic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916918804 1:169439794-169439816 CAGAGGGATAGGTGGGAAGCTGG + Intronic
916951571 1:169785478-169785500 CAGTGGGATGGATGGGGAGCTGG + Intronic
917539906 1:175902191-175902213 CAGTGGGATGGATGGGGAGCTGG - Intergenic
918058917 1:181045631-181045653 CAGTGTTATGGGATCCAAGCTGG - Intronic
919048998 1:192489223-192489245 CAGTGGGATGGCAGGCCAGCAGG - Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919807041 1:201386338-201386360 GAGTGTGACGGGTGGGAGGCGGG + Exonic
920047119 1:203140507-203140529 CACTGTGATGGCAGGGTCGCTGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920442463 1:205990023-205990045 TAGGGTGTGGGGAGGGAAGCTGG - Intronic
921411156 1:214837558-214837580 CAGAAACATGGGAGGGAAGCAGG + Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921632889 1:217456026-217456048 CAGTGAGATGGATGGGGAGCTGG - Intronic
922534594 1:226370560-226370582 CAGTGTGATCGCAGGAGAGCTGG + Intronic
923315225 1:232773554-232773576 CAGTGGGATGGAATGGGAGCTGG - Intergenic
923843321 1:237698655-237698677 CAGTGAGATGGGAGGGAGAGGGG + Intronic
1063647990 10:7904949-7904971 CAGTGTGAGGGAAAGGATGCAGG - Intronic
1063959766 10:11297490-11297512 CAGTGTCAGGGGAGCCAAGCAGG + Intronic
1064599352 10:16977525-16977547 CAGTGGGATGGATGGGGAGCTGG - Intronic
1064986178 10:21212442-21212464 CAGAGTGATGGGAGGAAAGAAGG + Intergenic
1065130228 10:22612955-22612977 CGGTGTGATGGGGAGGAAGGCGG + Intronic
1065347602 10:24764194-24764216 CTGTGTTATGGGAGGGACCCAGG - Intergenic
1065668469 10:28087806-28087828 CAGTGAGGTGGGAGAGGAGCAGG + Intronic
1065671293 10:28121059-28121081 CAGTGTTTTGGGAGGCAAGGTGG + Intronic
1066005102 10:31139747-31139769 CAGTGTGTTGGATGGCAAGCTGG + Intergenic
1066305119 10:34133027-34133049 CAGTGGGATGGATGGGAAGCTGG - Intronic
1066564830 10:36710557-36710579 CAGTGGGATGGATGGAAAGCTGG - Intergenic
1067785448 10:49242406-49242428 CAGTGAGTTGGTAGGGAAGCCGG - Intergenic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069860928 10:71471388-71471410 CACAGTGGTGGGAGAGAAGCAGG - Intronic
1069862419 10:71480005-71480027 CAGAGTCATGGGACTGAAGCAGG - Intronic
1070004386 10:72409080-72409102 CAGCATGATGTGTGGGAAGCGGG - Intronic
1070173443 10:73950354-73950376 CAGTGTGCGGGGAGAGAATCTGG + Intergenic
1071092608 10:81936476-81936498 AAGATGGATGGGAGGGAAGCAGG + Intronic
1071229918 10:83573605-83573627 CTGTGTGATGGGAAGGCACCTGG - Intergenic
1071332091 10:84570875-84570897 CAATGGGCTGGGAGAGAAGCGGG + Intergenic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1072422045 10:95297351-95297373 CAAGGTAGTGGGAGGGAAGCGGG + Intergenic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1073035492 10:100562039-100562061 CATTGAGGTGGGAGGGAACCTGG + Intergenic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074160031 10:110829551-110829573 GAGGGAGATGGGAGGGAAGGAGG - Intronic
1074543208 10:114383373-114383395 AAGGGTGAAGGGAGGGAAGGAGG + Intronic
1075647781 10:124107888-124107910 CAGGGTGATGGCAAGGAAGGCGG - Intergenic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1076102515 10:127794409-127794431 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1076713930 10:132353853-132353875 CACAGTGAGGGGAGGGCAGCTGG - Intronic
1076715993 10:132364059-132364081 CAGGGTGATGGGGGGTTAGCGGG - Intronic
1076820561 10:132936745-132936767 CTCTGTGCTGGGAGGGAGGCAGG + Intronic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1077147056 11:1051038-1051060 CACTGAGAAGGGAGAGAAGCTGG - Intergenic
1077275574 11:1705777-1705799 CAGTGTGGTGGGTGGGGGGCTGG + Intergenic
1077317438 11:1925687-1925709 CAGAGTGAGGGGAGAGAAGGCGG + Intronic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1077712444 11:4550847-4550869 CAGTGGGATGGGTGGGGAGCTGG - Intergenic
1077714746 11:4569575-4569597 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078421110 11:11213701-11213723 CAGTATGATTGGAGGAAAGGAGG - Intergenic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1078946156 11:16070840-16070862 AAGTGTGATGGGAGGGATATAGG - Intronic
1079402652 11:20118306-20118328 CAGGGTGATGTGGGGGATGCAGG - Exonic
1080502662 11:32885489-32885511 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1080723832 11:34875105-34875127 CAGTGGGATGGATGGGGAGCTGG - Intronic
1080944619 11:36957620-36957642 AAGTGTGTTGGGAGGGAAGTGGG + Intergenic
1081078567 11:38709128-38709150 CATTGTGATGCCAGAGAAGCTGG - Intergenic
1081881379 11:46455826-46455848 CAGTGTCATGGGAGGAAGGAAGG - Intronic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082798329 11:57394869-57394891 CAGGGTGTGGGGAGGGATGCAGG - Intronic
1083253807 11:61484512-61484534 GAGTGTGATGGGAAGGCTGCAGG + Intronic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1084092707 11:66889141-66889163 CAGGGTGAAGGGAGGGAAAGTGG + Intronic
1084173600 11:67412121-67412143 CAGTGTGTGGGGACTGAAGCTGG + Intronic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085037278 11:73308157-73308179 CCGCGTGGTGGGAGGGAATCAGG - Intergenic
1085085751 11:73665574-73665596 CAGTGTGATGGGTGGAAACGGGG + Intergenic
1085265642 11:75236435-75236457 CAGAGGGATGGGAAGGCAGCAGG + Intergenic
1087139159 11:94748854-94748876 CAGCTTGATGGGAAGGAAGTAGG - Intronic
1087886117 11:103484700-103484722 AAGTGTTTTGGGAGGGAGGCAGG - Intergenic
1088450622 11:109977758-109977780 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1088802664 11:113320518-113320540 CAGTGGGATGGATGGGGAGCTGG - Intronic
1088853618 11:113726203-113726225 CAGTGTTAGGGGGGTGAAGCGGG - Intergenic
1089134085 11:116235406-116235428 CCCTGTGCTGGGAGGGAAGGAGG + Intergenic
1089588516 11:119525000-119525022 CAGTGTGGAGGGAAGGCAGCTGG - Intergenic
1089596854 11:119585926-119585948 CAGGCTGATGGGAAGGAAGGTGG - Intergenic
1089611499 11:119672030-119672052 CAGTGTCCTGGAAGGGAGGCAGG - Intronic
1089683417 11:120132217-120132239 GAGGGTGCTGGGAGGGAAGCGGG - Intronic
1090803554 11:130189003-130189025 CAGTGTGTGGGGCAGGAAGCGGG + Intronic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091688217 12:2578713-2578735 GAAGGTGATGGGTGGGAAGCAGG + Intronic
1093686148 12:22056648-22056670 GAGTGTACTGGGTGGGAAGCTGG - Intronic
1095131011 12:38542504-38542526 GAGGGTGAGGGCAGGGAAGCTGG - Intergenic
1095448214 12:42303201-42303223 CAGTGGGATGGATGGGGAGCCGG + Intronic
1095644369 12:44525806-44525828 CAGTGTGATAGGAAGCAAGTAGG - Intronic
1095984701 12:47991541-47991563 GAGTCTGATGGGAGGGGAGAGGG + Intronic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1098209879 12:68152356-68152378 CAGTGTGTAGGGAGGAAACCTGG - Intergenic
1098744088 12:74213568-74213590 CAGTGGGATGGACGGGGAGCAGG + Intergenic
1098757667 12:74386947-74386969 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1100189828 12:92178525-92178547 AGGTGTGATGGGAGGGGAGGTGG + Intergenic
1100497405 12:95138633-95138655 CAGTGTGGTGGGAGAGAAATGGG - Intronic
1101637844 12:106560986-106561008 CTGGCTGATGGGAGGTAAGCAGG + Intronic
1102708528 12:114904923-114904945 TAGTGAGATGGGAGAGAAGTGGG + Intergenic
1103566756 12:121819917-121819939 GAGGGTGGTGGGAGGGAGGCAGG + Intronic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1104036458 12:125100779-125100801 GAGTGTTGTGGGAGGGAGGCTGG - Intronic
1104143309 12:126008766-126008788 TACTGTGATGGTAGGGAAGATGG - Intergenic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104612430 12:130240700-130240722 CCGGGTGAAGGGAGGGAAGAGGG + Intergenic
1105212018 13:18262504-18262526 CAGTGAGATGGGAGGGGGTCTGG - Intergenic
1105299458 13:19119011-19119033 GAGGGTGATGGGGGGGAAGTGGG + Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1105811739 13:24001646-24001668 CAGTGACTTGGGTGGGAAGCAGG + Intronic
1106465974 13:30015002-30015024 CAGTATGAAGGAAGGGGAGCTGG + Intergenic
1106823310 13:33490633-33490655 CAGTGTGGTGGATGGGAAGCTGG - Intergenic
1106879405 13:34112933-34112955 CAGTGGGATGGGTAGGAAGCTGG - Intergenic
1106891526 13:34251210-34251232 CAATGAGATGGGAGGAAAGGTGG + Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107446718 13:40475888-40475910 CAGTGAGCTGGGAGGGCAGCAGG - Intergenic
1108254645 13:48598561-48598583 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109268644 13:60229461-60229483 CAGTGTGATGGGGAGGGAGGAGG - Intergenic
1109300727 13:60587366-60587388 CAGAGGGATGGATGGGAAGCTGG - Intergenic
1109746778 13:66634231-66634253 CAGTCTGATGGGAGGGAGAGTGG + Intronic
1109789858 13:67231290-67231312 CAGTGAGGTGGGCTGGAAGCGGG - Intergenic
1111211043 13:85080780-85080802 CAGAGAGATGGGAGAGAAGGAGG + Intergenic
1111622840 13:90746583-90746605 CATTGTGATGTCAGGAAAGCTGG - Intergenic
1111855171 13:93628016-93628038 CAGTCTGATGGGCTGGAAGCAGG - Intronic
1112171489 13:96977169-96977191 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1113288330 13:108878450-108878472 CAGTGGGATGGATGGGGAGCTGG - Intronic
1113339918 13:109412432-109412454 CAGTGTGAGGGAGGGGAAGAGGG - Intergenic
1113913271 13:113854783-113854805 CTGTTGGATGGGAGGGATGCTGG + Intronic
1114567343 14:23642506-23642528 CAGCCTGATGGAGGGGAAGCAGG - Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116815654 14:49581258-49581280 AAGTGTGACAGAAGGGAAGCTGG - Intronic
1117312502 14:54542038-54542060 CAGTGAGATAGGAGGAAAACTGG + Intergenic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1117728212 14:58695048-58695070 CAGCCTCAAGGGAGGGAAGCTGG + Intergenic
1117944001 14:60998494-60998516 CAGTGAGATGGATGGGGAGCTGG - Intronic
1118258919 14:64229500-64229522 CATTGTGGTGGGAGGTAAGGGGG + Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118474291 14:66102367-66102389 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1118629423 14:67689216-67689238 CTGTGAGATGGGAAGGAAACTGG - Intronic
1118750646 14:68805835-68805857 AAGTGTGAGTGGAGGGAAACTGG + Intergenic
1119023812 14:71136956-71136978 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1119364810 14:74082920-74082942 CATTGTGATGGGAGGGGAAGAGG + Intronic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1120044187 14:79788248-79788270 ACGTGTCATGGGAGGGAACCCGG - Intronic
1121047072 14:90796110-90796132 CAGCTGGTTGGGAGGGAAGCTGG - Intronic
1122322040 14:100861086-100861108 TAGTGTGATGGGTGGGAGGGCGG + Intergenic
1122816611 14:104317111-104317133 CAGGATGGCGGGAGGGAAGCAGG - Intergenic
1123989659 15:25673995-25674017 GAGTGTGATGGGAGACAAGGAGG + Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124567129 15:30826625-30826647 CAGTGGGAGGGGCGGGAATCAGG - Intergenic
1124820065 15:33035916-33035938 GACTGTCATAGGAGGGAAGCTGG + Intronic
1124991323 15:34676890-34676912 CAGTGTGGTGGGAGAGCAGTGGG + Intergenic
1125446903 15:39767806-39767828 CAGTGAGATGGATGGGGAGCTGG - Intronic
1125756512 15:42069037-42069059 CAGAGAGCTGGGAGGAAAGCAGG - Intronic
1125863515 15:43020358-43020380 CAGTCTGATGGGAGAGATGAAGG - Intronic
1126132848 15:45359853-45359875 CAGTGTGATACGCTGGAAGCGGG - Intergenic
1126242398 15:46460200-46460222 CAGAGTGCTGGGAGGGAGGTGGG + Intergenic
1126780465 15:52135104-52135126 CCCTGTGATGGGAGGGAGGATGG + Intronic
1127666974 15:61157335-61157357 CTGTGTGATGGTAGGGAGGTAGG + Intronic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1127812132 15:62573582-62573604 CAGGGAGAGAGGAGGGAAGCTGG - Intronic
1127843161 15:62847492-62847514 CAGTGTGGTGGGAGGCCAGCAGG + Intergenic
1128709425 15:69860630-69860652 CAGTGTCATGGGAGAGAACATGG + Intergenic
1128769707 15:70272791-70272813 CAGTGTGATGCGAGGGCCGCAGG - Intergenic
1129614035 15:77083943-77083965 CTGAGTGATCGGAGAGAAGCCGG - Intronic
1129919414 15:79307319-79307341 CTCTGTGATGAGAGGGAGGCTGG + Intergenic
1129919535 15:79308715-79308737 CAGTGTGTTTAGTGGGAAGCTGG + Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130803428 15:87291945-87291967 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1131456880 15:92588540-92588562 TATTCTGTTGGGAGGGAAGCTGG - Intergenic
1132589471 16:720439-720461 GAGTGTGGTGGGAGGAAAGCCGG - Intronic
1132872754 16:2123062-2123084 CAGTGGGATGGGCGGGGAGCCGG - Intronic
1133089913 16:3396071-3396093 CAGAGTGATGGAAGGGGAACTGG + Intronic
1133386060 16:5371351-5371373 CAGAGTGATGCCAGGGATGCCGG + Intergenic
1134031781 16:10998034-10998056 CAATGGGATGGGAGGGAGGATGG - Intronic
1134276810 16:12783627-12783649 CAGTGTGATGGGTGGGAAAGTGG - Intronic
1134551840 16:15142241-15142263 CAGTGGGATGGGTGGGGAGCGGG - Intergenic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134610690 16:15605823-15605845 GAGTGTGATGGGTGGGCAGCTGG - Intronic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134771150 16:16810867-16810889 CAGAGTGATGGGAGTGACTCTGG + Intergenic
1134873676 16:17676180-17676202 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1135492236 16:22919511-22919533 CACTTAGATGTGAGGGAAGCTGG + Intergenic
1136105278 16:28025774-28025796 CAGTGTGTTGGGACAGAAGAGGG + Intronic
1137513161 16:49119004-49119026 CAGAGTGGTGGGAGGGCAGGAGG - Intergenic
1137548643 16:49421599-49421621 CAGTGTGATTGGACAGAGGCAGG + Intergenic
1138390873 16:56669216-56669238 TACTTTGATGGGAGGGAGGCAGG + Intronic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138554618 16:57764252-57764274 GAGGGTGGTGGGAGGGAGGCTGG + Intronic
1139412285 16:66773507-66773529 CCCTGTGATAGGAGGGAACCTGG - Intronic
1139588419 16:67919167-67919189 CAGAGTGGAGGCAGGGAAGCGGG + Intronic
1139924569 16:70479065-70479087 CAGTGTCATGGTAAAGAAGCCGG - Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1141157916 16:81609970-81609992 CAGTGTGGTGGCAGGGCAGAGGG + Intronic
1141188543 16:81806883-81806905 CAGAGTTATGGGGAGGAAGCAGG + Intronic
1141347914 16:83265203-83265225 CAGGGTGATGGCTGAGAAGCAGG - Intronic
1141845711 16:86607529-86607551 CTGTGTGTTGGGAGAGAAGGGGG - Intergenic
1141878551 16:86842646-86842668 CAGTGTGATGAGACTAAAGCTGG + Intergenic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1143092228 17:4455674-4455696 CAGTGTCGTGGGAGGGGAGAGGG - Intronic
1143270260 17:5670012-5670034 CAGGCTGATGGAAGGGAGGCAGG - Intergenic
1143278376 17:5731456-5731478 AGGTGGGATGGGAGGGAAGGAGG + Intergenic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143501693 17:7343122-7343144 GAGTGAGATGGGAGAGAAGGGGG + Intronic
1143570853 17:7757454-7757476 CAGTGGGGTGGGAGGGGACCTGG - Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143857251 17:9861069-9861091 CGCTGTGGTGGGAGGCAAGCAGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144790262 17:17854293-17854315 CAGGCTGATGGGAGGGAAGTGGG + Intronic
1144857202 17:18275991-18276013 CAGTGTGAAGGGAGGCTGGCTGG - Intronic
1145235137 17:21202706-21202728 CAGTGAGGTGGGAGGGAGCCTGG - Intronic
1145788372 17:27608883-27608905 CAGGGTGATGGGCAGGGAGCCGG - Intronic
1145835569 17:27952125-27952147 GCGTGGGATGAGAGGGAAGCAGG + Intergenic
1146601162 17:34217783-34217805 CACTCTGATGATAGGGAAGCTGG + Intergenic
1146696389 17:34911751-34911773 CATTGTGATGGGTGGGAATGGGG + Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151345212 17:73497263-73497285 CAGTGTCTTGGGAGGAAAGAGGG - Intronic
1152011305 17:77720140-77720162 CAGTGTGATGGTATCGAAGGAGG - Intergenic
1152137300 17:78512051-78512073 CAGTGTGGTGGGGGCGGAGCAGG + Intronic
1152181601 17:78825597-78825619 CTGTGAGATGGGAGGAATGCAGG - Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1152401901 17:80071411-80071433 CAGTGTCCTGGGAGAGAACCCGG + Intronic
1152496637 17:80677515-80677537 GAGTCTGGTGGGAGGGAAGGTGG - Intronic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1153943484 18:9997095-9997117 CAGTTTCCTGAGAGGGAAGCTGG - Intergenic
1154155922 18:11944046-11944068 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1154217281 18:12424274-12424296 AAGTCTGATGGGAAGGAAACAGG + Intronic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155843033 18:30669346-30669368 ATGTGTGATGGGAGGGACCCAGG - Intergenic
1155908709 18:31484206-31484228 ATGTGTGATTGGAGGGATGCTGG - Intergenic
1156226889 18:35118303-35118325 CAGTGGATTGGGAGGGAAACCGG + Intronic
1156455418 18:37290628-37290650 GATTGTGGTGGGAGGGAAGCAGG + Intronic
1157181695 18:45504059-45504081 CAGTAAGATGGAAGGGAAGGAGG + Intronic
1157323768 18:46654639-46654661 GAGTGTGATGGGGAGGAAGAAGG - Intronic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1158281233 18:55830703-55830725 CTTCGTGATGTGAGGGAAGCTGG + Intergenic
1158622472 18:59045035-59045057 CATTCTGCTGGGAGGGAGGCAGG + Intergenic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1159648599 18:70950427-70950449 CAGGCAGATGGGAGGGAAGGGGG - Intergenic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1159946341 18:74447092-74447114 CAGGCTGAGGGGCGGGAAGCTGG + Exonic
1160196275 18:76758226-76758248 CAGTGTGACGGTAGGGGTGCGGG - Intergenic
1160266713 18:77344766-77344788 TGGTGTGATAGGAGGGAGGCTGG - Intergenic
1160625535 18:80201828-80201850 CAGGGTGCTGGGTGGGAGGCGGG - Intronic
1160659152 19:290495-290517 CTGTGAGATGGCAGAGAAGCAGG + Intronic
1160673777 19:377918-377940 CAGGGAGATGGGATGGGAGCTGG - Intergenic
1160816155 19:1036691-1036713 CAGAGAGCGGGGAGGGAAGCCGG - Intronic
1161186431 19:2924449-2924471 TTGTATGATGGGAGGGAAGCTGG - Intergenic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1162328911 19:10015005-10015027 CAGTGTGATTTGTGGGTAGCAGG - Intronic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162497081 19:11029313-11029335 CACTGGGATGGGTGGGAACCAGG - Intronic
1163000391 19:14363360-14363382 GAGGGTGCTGGGACGGAAGCGGG - Intergenic
1163371453 19:16903491-16903513 CTGTGTGATTGGAGGGAATGGGG + Intronic
1164908032 19:31983611-31983633 CTATGTGATGGGAGGGAAAAAGG + Intergenic
1164968568 19:32509915-32509937 CAATGTCAGGGGAAGGAAGCTGG + Intergenic
1165078910 19:33296700-33296722 GGCTGTGAGGGGAGGGAAGCTGG - Intergenic
1166357218 19:42234328-42234350 CAGAGTTATGGGAGGGTGGCGGG - Intronic
1166397938 19:42456163-42456185 TAGTGTGATGAGAAGGAAGCAGG - Intergenic
1166413827 19:42577258-42577280 AAGTGTAATGGGAAGGAAGTAGG - Intergenic
1166772807 19:45294471-45294493 CAGGGTGAGGGGTGGGAAGTAGG + Intronic
1167403608 19:49289397-49289419 ACGTGTTATGGGAGGGAACCAGG + Intergenic
1167732388 19:51268058-51268080 CAGGGTGTTAGGAGGGCAGCAGG - Intronic
1168251275 19:55143648-55143670 CAGAGGGGTGGGAGGCAAGCCGG - Intronic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
925642988 2:6005318-6005340 CAGTGGGATGGGAGAGACGGTGG - Intergenic
925805771 2:7646249-7646271 ATGTGTTATGGGAGGGAACCAGG - Intergenic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
926123492 2:10257294-10257316 CAATGTGGTGGGAGGGCAGATGG - Intergenic
926147244 2:10404303-10404325 CAGTGTGCTGGGAGGCAAAAGGG - Intronic
926281268 2:11448914-11448936 TAGTGTGATGGGTGGCAAACTGG - Intronic
926506451 2:13721883-13721905 CAGTGGGATGGATGGGGAGCTGG - Intergenic
927179424 2:20434090-20434112 GACTGTGATGGGAGGGAGGAGGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927322395 2:21762567-21762589 CAGTGGGATGGATGGGGAGCTGG + Intergenic
927484619 2:23479957-23479979 CAGCGTGGTGGCAGGGAACCTGG + Intronic
927505168 2:23608150-23608172 CAGCATGATGGGAGGGAAAAAGG + Intronic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
928401163 2:30979719-30979741 CAATGGGATGTGATGGAAGCAGG - Intronic
930919856 2:56739405-56739427 AAGAGAGAAGGGAGGGAAGCAGG - Intergenic
931635013 2:64332991-64333013 AAGTGTGGTGGAAGGGAAGGGGG - Intergenic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
933409751 2:81910242-81910264 CAGTGGGATGGATGGGGAGCTGG + Intergenic
933425953 2:82112551-82112573 CAGTGGGATGGATGGGGAGCTGG - Intergenic
933678263 2:85076911-85076933 AAGTCAGATGGGAGGGCAGCTGG + Intergenic
934092470 2:88564826-88564848 CAGTGTAATGGGATGGACCCAGG + Intronic
934301608 2:91779904-91779926 CAGTGAGATGGGAGGGGGTCTGG + Intergenic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
936267728 2:111023215-111023237 CAGGGAGATGAGAGGGGAGCGGG + Intronic
936370162 2:111897123-111897145 CTGTATGCTTGGAGGGAAGCGGG - Intergenic
936928792 2:117765276-117765298 GAGGGTGAAGGGAGGGAAGGAGG + Intergenic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
939139505 2:138336617-138336639 CAGTGTGATGAGACGCAATCAGG + Intergenic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
939450455 2:142367062-142367084 CAGTGGGATGGATGAGAAGCTGG + Intergenic
939760155 2:146165671-146165693 AAGTGTCATGGGAGGGACCCGGG - Intergenic
939949151 2:148447596-148447618 CAGGCTGATGGGAATGAAGCAGG + Intronic
940321811 2:152385326-152385348 CAGTTTGTAGGGAGGGAGGCTGG + Intronic
942360724 2:175168572-175168594 CGGTGTGAGGGGAGGAAAGGTGG + Intergenic
942620420 2:177839158-177839180 CATGGTGATGGCAGGGAGGCTGG - Intronic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
946453725 2:219803402-219803424 CAGTCTGAGGGGAAGTAAGCTGG + Intergenic
946832529 2:223741055-223741077 CAGTGAGATGGGTGGGGAGTGGG + Intergenic
947892991 2:233643118-233643140 CATTCTGAAGGGAGGGATGCAGG - Intronic
947907299 2:233774689-233774711 CAGTTTGATAGGAGAAAAGCAGG + Intergenic
947980351 2:234403447-234403469 CAGGGTGATGGGATGGCCGCTGG - Intergenic
948554287 2:238796552-238796574 CAGGAGGATGGGAGGGAACCAGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169867417 20:10217233-10217255 CATTGCGGAGGGAGGGAAGCGGG - Intergenic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1172963223 20:38813450-38813472 CAGACTGATGGAAGGGAAGGTGG + Intronic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173282716 20:41643691-41643713 CAGACTGATAGGAGTGAAGCTGG - Intergenic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1173934642 20:46850704-46850726 CCGTGTGATGTCAGGGAAGCGGG + Intergenic
1174061588 20:47836750-47836772 CAGTGAGATAGGAGAGGAGCAGG + Intergenic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174394497 20:50238288-50238310 CTGTGTGATGGAATGCAAGCCGG + Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1176061220 20:63173781-63173803 CAGTGTGGAGCGAGGGGAGCTGG - Intergenic
1176373772 21:6077351-6077373 CAGAGTGGTGGGTGGGAAGAAGG + Intergenic
1176606637 21:8839497-8839519 CAATGGGATGGATGGGAAGCTGG + Intergenic
1176981016 21:15381057-15381079 CAGTGCGATGGATGGGGAGCTGG - Intergenic
1177605053 21:23367239-23367261 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1178213742 21:30569219-30569241 CAGTGAGATGGATGGGGAGCTGG - Intergenic
1178640577 21:34342281-34342303 CAGCGAGGTGGGAGGGAAGGAGG + Intergenic
1178793358 21:35721083-35721105 CAGTGTGGTGGAAGGAAAGTGGG - Intronic
1179110056 21:38438670-38438692 CAATGTGGCGGGAGGGAAGGAGG + Intronic
1179749705 21:43460892-43460914 CAGAGTGGTGGGTGGGAAGAAGG - Intergenic
1179912743 21:44459082-44459104 CAGCGTGGCGTGAGGGAAGCAGG - Exonic
1180135524 21:45859635-45859657 CAGTGTGATGGGTGGGCGCCTGG + Intronic
1180177544 21:46097976-46097998 GAGGGGGATGGGAGGGAAGCGGG - Intergenic
1180918515 22:19506195-19506217 CACTGTGATGGCTGGGAAGGAGG + Intronic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181318190 22:21984822-21984844 CAGGGTGGTGGCAGGGAGGCAGG - Intergenic
1181700723 22:24619816-24619838 CAGTGAGATGGGAGGGGGTCTGG + Intronic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1182303811 22:29354069-29354091 CATTCTCATGGGAGGGAAGTGGG + Intronic
1183483659 22:38078064-38078086 CAGGGTGGTGGGAGGGAGTCTGG - Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183754394 22:39746727-39746749 CAGGGTGCTGGGAGGCCAGCAGG + Intronic
1183958936 22:41399260-41399282 TGATGTGGTGGGAGGGAAGCCGG + Exonic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
1184473546 22:44709022-44709044 CAGTGATTTGGGACGGAAGCTGG + Intronic
1184516155 22:44964029-44964051 CTGTGTGTTGGGAGGGTTGCTGG + Intronic
1184592361 22:45493563-45493585 CAGGGAGCTGGGAGGGCAGCTGG + Intergenic
1184666049 22:45989721-45989743 CTGTGTGGTGTGGGGGAAGCAGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
949627490 3:5883506-5883528 TAGGGTGATTGGAGGGAAGAGGG + Intergenic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950452308 3:13072295-13072317 CAGAGAGCTGTGAGGGAAGCTGG + Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950602973 3:14051560-14051582 CAGGGTGATGGAAGGGAGGGGGG - Intronic
950723222 3:14899255-14899277 CAGAGAGATGGGAGGGAAGTGGG - Intronic
951577803 3:24131582-24131604 CAGTGTGATGGTATTGAAGGCGG + Intronic
953616806 3:44497964-44497986 CAGTGTAATGGGAGGGAGACGGG + Intergenic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
956847946 3:73201296-73201318 CAGTTTGATGGTGGGGAAACTGG - Intergenic
957521065 3:81319196-81319218 CATTGTGTTGAGAGGGATGCAGG - Intergenic
957984968 3:87562473-87562495 CAGCGGGATGGATGGGAAGCTGG - Intergenic
959254088 3:103989061-103989083 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
959430908 3:106253933-106253955 AAGTGTGTTTGGAGGGTAGCTGG - Intergenic
959631430 3:108511373-108511395 CATGGTGATGTGAGTGAAGCTGG + Intronic
959857354 3:111175011-111175033 CAGTGGGATGGATGGGGAGCTGG + Intronic
959984945 3:112561898-112561920 GAGTGAGAAGGAAGGGAAGCCGG - Exonic
960291573 3:115891785-115891807 AAGTGTGATGGAAGAGAAGAGGG - Intronic
960747465 3:120906375-120906397 CATTTTGATGGGAGCGAAGAAGG - Intergenic
960855534 3:122098533-122098555 CAGTGTGAGGGGAAGGGATCTGG + Intronic
960914067 3:122679731-122679753 CCGAGTGATGGGAGAGAAGCTGG - Intergenic
961343122 3:126243645-126243667 CAGTGGGATGGATAGGAAGCTGG + Intergenic
961387254 3:126529751-126529773 CAGGATGATGGGAGGGGAGGAGG - Intronic
963584024 3:147161647-147161669 AAGTGTCAGGGGAGGAAAGCGGG - Intergenic
964334060 3:155636114-155636136 CAGTGAGATGTGAGGGAAGTTGG - Intronic
965220519 3:165921092-165921114 CTGAGTGTTGGGAGAGAAGCTGG + Intergenic
966347700 3:178997550-178997572 CAGTGGGATGGATGGGGAGCTGG - Intergenic
966916554 3:184587486-184587508 GAGAGAGATTGGAGGGAAGCTGG + Intronic
968481829 4:836729-836751 CAGTGTGCTGGGAGGGACCTGGG - Intergenic
968577103 4:1372549-1372571 CAATGTGATGGGGTGGAAGGAGG - Intronic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969460202 4:7324993-7325015 CCGTGAGATGGGAGGGCAGAAGG + Intronic
969680004 4:8637599-8637621 CTGTGTGGTGGGCGGGGAGCTGG + Intergenic
970067550 4:12116216-12116238 CACTGTGATCTCAGGGAAGCAGG + Intergenic
970813988 4:20131399-20131421 CAGTGAGATGGATGGGGAGCGGG + Intergenic
971502057 4:27328355-27328377 CAGTGGGATGGATGGGAAGCTGG + Intergenic
971774598 4:30946471-30946493 CAGTGTGGTGGGAGGGAGGTGGG - Intronic
973371475 4:49251660-49251682 CAATGGGATGGATGGGAAGCTGG - Intergenic
973389533 4:49543651-49543673 CAATGGGATGGATGGGAAGCTGG + Intergenic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
974121121 4:57640327-57640349 CAGTGAGATGGATGGGGAGCCGG - Intergenic
975060093 4:69986189-69986211 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
975302718 4:72809622-72809644 GAGTGAGGTGGGAGGGAAGTGGG + Intergenic
975538122 4:75473558-75473580 CAGTGTGATGAGAGCTAAGGTGG - Intergenic
975745162 4:77468143-77468165 CAGGGTGATGGGACTGAAGAAGG + Intergenic
977026224 4:91822075-91822097 ATGTGTTATGGGAGGGAACCAGG - Intergenic
977065158 4:92304871-92304893 AAGTGTGAGGGAAGGGTAGCGGG - Intronic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
979301114 4:119088463-119088485 GAGGGTGATGGGAGGGAGGAGGG - Intergenic
979952498 4:126910804-126910826 GACTTGGATGGGAGGGAAGCTGG + Intergenic
980143969 4:128957882-128957904 CAGTGAGATAGGAGGAAAACCGG - Intronic
980488332 4:133490656-133490678 AAGGGTCATGGGAGGGAAACTGG + Intergenic
980554613 4:134387063-134387085 CAGTGGGATGGATGGGGAGCTGG - Intergenic
981027140 4:140088201-140088223 AAGTGTGATGGGAGGGAGGAAGG + Intronic
981362773 4:143866560-143866582 CAGTGGGATGGATGGGGAGCTGG - Intergenic
983382072 4:167008838-167008860 CAGCAAGAAGGGAGGGAAGCAGG + Intronic
983798893 4:171902621-171902643 CAGTGAGAGGGTAGGGAGGCTGG + Intronic
983810191 4:172051462-172051484 CAGTGGGATGGAGGGGGAGCTGG + Intronic
984869384 4:184313111-184313133 TAATGTGCTGGGAGAGAAGCTGG + Intergenic
985228147 4:187784686-187784708 CAGTGAGATGGATGGGGAGCTGG - Intergenic
985293184 4:188407030-188407052 CAGTGGGATGGATGGGGAGCTGG - Intergenic
985702056 5:1379431-1379453 CCGTGTGGTGCGGGGGAAGCCGG - Intergenic
985896368 5:2751820-2751842 CAGAGAGACGGGAGGGAGGCGGG + Intergenic
986013922 5:3740924-3740946 CAGTGAGGTGTGAGGAAAGCCGG - Intergenic
986454546 5:7903309-7903331 CAGGATGATAGGAGGGCAGCAGG - Intronic
986457774 5:7937391-7937413 CAAAGTGATGGGATGGAAGTAGG - Intergenic
987115913 5:14726553-14726575 AAGAGTGACGGGAGGGAGGCTGG + Intronic
987190221 5:15469910-15469932 CAGTGAGATGGATGGGGAGCTGG + Intergenic
987876855 5:23690748-23690770 CCGAGTGTTGGGAGGGAAACAGG + Intergenic
988113716 5:26855694-26855716 CAGAGTGGTGGGTGGGATGCGGG + Intergenic
989719128 5:44504025-44504047 CAGTGGGATGGTTGGGGAGCTGG - Intergenic
989997210 5:50849962-50849984 GAGAGGGATGAGAGGGAAGCAGG - Intergenic
990512509 5:56501433-56501455 TGGTGTGATTGGAGGGAATCTGG - Intergenic
991522944 5:67520641-67520663 AAGTGTGATGGAAAGGAAGGGGG - Intergenic
994920259 5:106033504-106033526 AAGTGTTGTGGGAGGGAAACAGG - Intergenic
995494479 5:112726325-112726347 CAGTGAGATGGATGGGGAGCTGG + Intronic
999277606 5:150341818-150341840 CACTGTGGTGTGAGGGAACCAGG + Intergenic
999479235 5:151930367-151930389 CAGTGTCATTGGAAGGAAGGAGG + Intergenic
999668491 5:153937311-153937333 CAGTGGGATGGATGGGGAGCTGG + Intergenic
999702693 5:154242602-154242624 GAGAGTGACAGGAGGGAAGCAGG - Intronic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1001352405 5:170981456-170981478 ACGTGTTGTGGGAGGGAAGCAGG + Intronic
1001485209 5:172115097-172115119 CAGTGTGGTGGGTGGGGAGATGG - Intronic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1001977247 5:176010081-176010103 CAGTGCGATGGATGGGGAGCTGG - Intronic
1002119908 5:176994969-176994991 CAGTGTGCTGGGAGAGTATCTGG + Intronic
1002240178 5:177833699-177833721 CAGTGCGATGGATGGGGAGCTGG + Intergenic
1002453146 5:179331076-179331098 CAATGTGCTGGGAGGAAATCAGG - Intronic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003167840 6:3696901-3696923 CGGTGAGATGGAAGAGAAGCAGG + Intergenic
1003593141 6:7452725-7452747 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1004479771 6:16007469-16007491 GAGTGTGATGGGATGGGTGCAGG - Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1006745591 6:36339667-36339689 CCATGTGCTGGGAGGGAAGATGG + Intergenic
1006991961 6:38222598-38222620 CATTGTGAGGGGAGGGCACCAGG + Intronic
1007115980 6:39343622-39343644 CAGTGAGGTGGGAGGGGAGTAGG - Intronic
1007134439 6:39507735-39507757 CAGTGTGATGGAAGGAAGGAAGG - Intronic
1007155113 6:39735296-39735318 CAGTTTGATTGGAGGGAAAGGGG - Intergenic
1007661767 6:43491029-43491051 CAGTGTGGTGCTAGGGAGGCTGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007946540 6:45832219-45832241 CAGTGTGGTGAGTGGGAAACAGG + Intergenic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1008494153 6:52115793-52115815 GAGGATGATGGGAGGGAAGGAGG + Intergenic
1009271319 6:61618614-61618636 GAGTGTGATGGGTGTGAAGAGGG - Intergenic
1009404087 6:63291403-63291425 CAGTGGGATGGTTGGGGAGCAGG + Intronic
1009955096 6:70444154-70444176 TAGTGCTTTGGGAGGGAAGCAGG + Intronic
1011411634 6:87072532-87072554 CATTTTTATGTGAGGGAAGCTGG - Intergenic
1011491826 6:87900743-87900765 CAGTGGGATGGATGTGAAGCTGG + Intergenic
1011510308 6:88093394-88093416 CAGTGGGATGGATGGGAAGCTGG - Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1012626196 6:101406033-101406055 CAAAGAGATGTGAGGGAAGCAGG - Intronic
1012945462 6:105461173-105461195 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1013088593 6:106877644-106877666 GAGTTTGATGGAAGGGAAGAAGG - Intergenic
1013526887 6:110982325-110982347 CCGTGGGATGGGAGGGATGTGGG + Intronic
1014136620 6:117896813-117896835 CAGTGAATTGGGAGGAAAGCTGG + Intergenic
1014299662 6:119665682-119665704 CAGTGGCATGGGTGGGAACCGGG + Intergenic
1014719455 6:124898344-124898366 AAGTGGGATGGGAAGGAAGGTGG - Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017791055 6:157799810-157799832 CAGTGTTGTGGGAGGGACCCAGG - Intronic
1018433592 6:163742545-163742567 CAGGGTGGTGGGAGGCATGCAGG - Intergenic
1018902842 6:168059960-168059982 CTTTCTGATGGGAGGGAAGCTGG + Intronic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1021150933 7:17149946-17149968 AAGTGAGATGGGAGGGGAGGAGG - Intergenic
1021277073 7:18664630-18664652 ATGTGTGAGGGGTGGGAAGCAGG - Intronic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1022372287 7:29783253-29783275 CAGTGATATGGGAGGGAGACAGG + Intergenic
1023607476 7:41943351-41943373 GAGTGTGGAGGGAGGGAAGGAGG + Intergenic
1023747639 7:43336493-43336515 CAGAGTCCTGAGAGGGAAGCTGG - Intronic
1024350193 7:48355644-48355666 CAGTGTGGTAGCAGAGAAGCTGG + Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1026567551 7:71501919-71501941 TAGTGAAATGGGAGGGAAGAAGG - Intronic
1026578740 7:71596531-71596553 TAGTGAAATGGGAGGGAAGAAGG + Intronic
1026794833 7:73359499-73359521 CAGCGAGATGGGACGGCAGCGGG - Intergenic
1027190496 7:75993474-75993496 CAGTGTGAGGAGAGCCAAGCAGG + Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028657118 7:93221078-93221100 CAGAGAGATGGGACAGAAGCTGG + Intronic
1030094406 7:105885259-105885281 CTGGGTGGTGGGAGAGAAGCAGG + Intronic
1030180667 7:106705528-106705550 CAGGATGATGGAAGAGAAGCAGG - Intergenic
1030913719 7:115285543-115285565 CAGAGTGAAGGAAGGGAAGATGG + Intergenic
1031133549 7:117861241-117861263 CAGCGTGATGGAAGGGGAGCTGG - Exonic
1032098735 7:128955147-128955169 CGGCGTGGTGGGAGGGGAGCTGG - Exonic
1032836886 7:135682916-135682938 CAGTAAGATGGGAGGGGAGAGGG + Intronic
1032900223 7:136299085-136299107 CACTGTGATGGGATGGAATGTGG - Intergenic
1032909496 7:136413277-136413299 CAGTGAGATGGGTGGTCAGCAGG - Intergenic
1033537986 7:142329226-142329248 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033551527 7:142452009-142452031 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033573313 7:142655519-142655541 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1033629279 7:143140939-143140961 CAGTGGGATGGATGGGGAGCCGG + Intergenic
1033963812 7:146948950-146948972 AAGTGTGATGGAGAGGAAGCAGG + Intronic
1034099391 7:148437994-148438016 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1034841883 7:154405643-154405665 CAGTGTGAGGGGACTGGAGCTGG + Intronic
1035074451 7:156169011-156169033 CAGTGTGTGGGGTGGGATGCTGG + Intergenic
1035180032 7:157082625-157082647 CAGTGTGATTGAAGGGATGCAGG + Intergenic
1035370350 7:158375879-158375901 CAGTGGGATGGATGGGGAGCTGG - Intronic
1037084377 8:14829186-14829208 CAGAGTGTTGGGGTGGAAGCAGG - Intronic
1037480226 8:19298241-19298263 CATTGTGATGAGAGGAAAGGAGG + Intergenic
1037760783 8:21740130-21740152 CAGTGTGATGACAGAGCAGCTGG + Intronic
1037796273 8:21997836-21997858 CAGTGTGGTGGGGGGGAGGAAGG + Intronic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1039617751 8:38969791-38969813 CAGTGCCATGGGAGGGAGGGAGG + Exonic
1040067886 8:43163111-43163133 CAGTGAGGTGGGAGGGAGGTTGG + Intronic
1040392171 8:46959639-46959661 CAGTGTGATTGCAGGGAATTTGG + Intergenic
1040879949 8:52193547-52193569 CTGTCAGATGTGAGGGAAGCGGG - Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041629828 8:60074664-60074686 AATTGTAATGGGAGGGAAGTTGG - Intergenic
1041929054 8:63267285-63267307 CAATCTGGTGGGAGGGAAGGGGG + Intergenic
1042120620 8:65484068-65484090 CAGTTGGATGGGAGGGATGGAGG + Intergenic
1042348526 8:67751789-67751811 CAGTGGGATGGATGGGGAGCCGG + Intergenic
1042601440 8:70503181-70503203 CAGTGGGATGGATGGGAAGCTGG + Intergenic
1043014109 8:74916803-74916825 CAGTGTGATTGCAGAGGAGCAGG + Intergenic
1043702005 8:83300816-83300838 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1044053944 8:87544233-87544255 TAGTGTCAGTGGAGGGAAGCTGG - Intronic
1045257114 8:100535543-100535565 GACTGGCATGGGAGGGAAGCAGG - Intronic
1046567260 8:115917672-115917694 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1046774973 8:118154261-118154283 CAGTGTGATGAGAGGACAGATGG - Intergenic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1047037623 8:120956724-120956746 CAGAGTGGTGGGAGAGAGGCAGG + Intergenic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047215883 8:122875751-122875773 CAGTGAGATGGGACAGAACCAGG + Intronic
1047878452 8:129166691-129166713 AAGAGGGATGGGAGGGATGCAGG - Intergenic
1049305135 8:141898692-141898714 CAGAGTCATGGGTGGGAAGCTGG + Intergenic
1049585987 8:143432598-143432620 CAGTGCGATGGGCGGGAGGGGGG - Intergenic
1050785263 9:9393010-9393032 CTGTGTGATGGGGCGGGAGCTGG + Intronic
1051193875 9:14542437-14542459 CAGGGAGATGGGAGTGAAGGAGG - Intergenic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051692656 9:19732796-19732818 CAGGCAGATGGGAGGGCAGCTGG - Intronic
1053026545 9:34734224-34734246 AAGCTTGATGGGAGGGAAGTGGG - Intergenic
1053357075 9:37455332-37455354 CAGTGGGATGGATGGGGAGCTGG - Intronic
1055839935 9:80491409-80491431 TTCTGTGATGGGAGGGAAGTGGG - Intergenic
1057249921 9:93492902-93492924 AAGTGGGATGGGAGTGAAGCAGG + Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1058093861 9:100836995-100837017 CAGTGGGATGGATGGGCAGCTGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1060182762 9:121545670-121545692 CAGTGCGAGGGGAGGGCCGCTGG + Intergenic
1060439859 9:123628313-123628335 CAGTGACATGGGAGGGAGGAAGG + Intronic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1060870953 9:127039768-127039790 CAGTGAAATGGGAGGGAAAGGGG + Intronic
1061179173 9:129013883-129013905 CAGTGAGCTGGGAGTGAAGGGGG + Intronic
1061438382 9:130580972-130580994 CAGAGTGGTGGAAGGGGAGCTGG - Intronic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061887636 9:133600581-133600603 CAGTGGGATGGGGTGGGAGCAGG + Intergenic
1062127375 9:134870814-134870836 GAGGGAGGTGGGAGGGAAGCTGG + Intergenic
1062170651 9:135133028-135133050 CAGTTTGAAGGGTGGGAAACCGG + Intergenic
1062644488 9:137540514-137540536 CACAGTGATGTGAGGGGAGCAGG - Intronic
1203553945 Un_KI270743v1:190357-190379 CAATGGGATGGATGGGAAGCTGG + Intergenic
1186039233 X:5457723-5457745 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1186047440 X:5551917-5551939 CAGTGATATGGGAGGGGAGCAGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1190157337 X:48004611-48004633 CAGTGTGTTGGGAGTGTAGGGGG + Intronic
1190173107 X:48127496-48127518 CAGTGTGTTGGGAGTGTAGGGGG + Intergenic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1194347780 X:92786992-92787014 GATAGTGATGTGAGGGAAGCAGG - Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1196002028 X:110796163-110796185 CTGTGTGATGGGAAAGTAGCCGG - Intergenic
1196777065 X:119348151-119348173 CAGAGTGGTGGGAGTGAAGATGG + Intergenic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1198147038 X:133867961-133867983 CAGTGGGATGGACGGGGAGCTGG - Intronic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1198831886 X:140759605-140759627 CAGTGACTTGGGAGGGAGGCAGG - Intergenic
1198852084 X:140975435-140975457 CACTGTGTTGGGAGGGCAGGTGG + Intergenic
1200656105 Y:5903628-5903650 GATAGTGATGTGAGGGAAGCAGG - Intergenic
1201300736 Y:12502570-12502592 CAGTGGGATGGTTGGGGAGCTGG - Intergenic
1202075055 Y:21029032-21029054 CAGTGAGATGTGAAGGCAGCTGG - Intergenic
1202301224 Y:23416688-23416710 CACTGTGATGGTAGGGGATCGGG + Intergenic
1202569587 Y:26253910-26253932 CACTGTGATGGTAGGGGATCGGG - Intergenic