ID: 1139991326

View in Genome Browser
Species Human (GRCh38)
Location 16:70941715-70941737
Sequence TGCTGAAGGCCATTGGCAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139991326_1139991333 -8 Left 1139991326 16:70941715-70941737 CCGGCTGCCAATGGCCTTCAGCA 0: 2
1: 0
2: 0
3: 16
4: 186
Right 1139991333 16:70941730-70941752 CTTCAGCAGGCAGAGGAGGGCGG 0: 2
1: 1
2: 63
3: 1470
4: 18099
1139991326_1139991334 24 Left 1139991326 16:70941715-70941737 CCGGCTGCCAATGGCCTTCAGCA 0: 2
1: 0
2: 0
3: 16
4: 186
Right 1139991334 16:70941762-70941784 TCTGAGCAAAGAGAGTGTCGAGG 0: 1
1: 1
2: 1
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139991326 Original CRISPR TGCTGAAGGCCATTGGCAGC CGG (reversed) Exonic
903358700 1:22763538-22763560 TGCTGAAGGGCATTTGAAGTGGG - Intronic
905920025 1:41713126-41713148 TGCTGCAGGCCATAGGCTCCTGG - Intronic
906554869 1:46701640-46701662 AGCTGAAAGCCAATGCCAGCAGG + Intronic
906762264 1:48386874-48386896 TCCTGGAGCCCAGTGGCAGCAGG + Intronic
907083611 1:51648295-51648317 AGCTGAAGATCACTGGCAGCTGG + Intronic
911090371 1:94012678-94012700 TGCTGCAGGCCAGAGGCAGCGGG - Intronic
911871682 1:103107802-103107824 TGGTGAAGGGCATTTTCAGCAGG + Intronic
914342658 1:146773613-146773635 TGCTGAAGGCCATTGGCAGCCGG + Intergenic
915256239 1:154632190-154632212 TGATCAAGCCCATTGACAGCTGG - Intergenic
919620663 1:199861207-199861229 GGCTGACAGCCTTTGGCAGCAGG - Intergenic
920544124 1:206801407-206801429 GACTCAAGGCCATTGGCACCTGG + Intronic
922243710 1:223774481-223774503 TGCTGAACACCATTGGTTGCAGG + Intronic
923363597 1:233236894-233236916 TGCTGAAGGGCACTGACGGCAGG + Exonic
1066063657 10:31746204-31746226 TGCTGAAGCCCATGGCCAGGTGG - Intergenic
1070621917 10:78019393-78019415 TACTCAAGACCATAGGCAGCAGG - Intronic
1070753327 10:78976636-78976658 TGCTGAAGGCCATCAGCTGCTGG - Intergenic
1070835360 10:79444442-79444464 TGCAGAAGGCGCTGGGCAGCTGG + Intronic
1070837547 10:79459502-79459524 TGCTGAGAGCCAGTGGAAGCTGG - Intergenic
1071195400 10:83153502-83153524 ACCTGCAGGCCATTGGCAGCGGG + Intergenic
1072342901 10:94472338-94472360 TGCTGAAGGTCATTACCAGCAGG - Intronic
1075594982 10:123722670-123722692 TGTTGAAGGTAATAGGCAGCAGG - Intronic
1075846880 10:125551960-125551982 TGCTGATGGCCATGGGGATCTGG - Intergenic
1076946821 10:133657271-133657293 GGCTCAGGGCCATAGGCAGCCGG + Intergenic
1078439453 11:11351948-11351970 TGCTGAGCGCCAGTGGCAGCTGG + Exonic
1079400786 11:20104788-20104810 TCCTGCAGGCCATAGGGAGCTGG - Intronic
1079654757 11:22974109-22974131 TGCAGCTGGCCAGTGGCAGCAGG - Intergenic
1085232158 11:74981552-74981574 GGGTGTAGGCCATGGGCAGCTGG + Intergenic
1085641915 11:78198050-78198072 TGCTGACTGCCATTAGCAGGTGG + Exonic
1088899220 11:114102554-114102576 TGCGGAAGGGCAGGGGCAGCCGG - Intronic
1089579689 11:119473673-119473695 TGGTGAGGGCCACTGACAGCAGG + Intergenic
1090904471 11:131063083-131063105 TGCTGAAGGATATTGGCTGATGG - Intergenic
1095569770 12:43671413-43671435 TGATGAAGGGCATTTGCAACAGG + Intergenic
1096786771 12:54021389-54021411 TGCTCCAGGCCACAGGCAGCGGG - Intronic
1101579720 12:106031931-106031953 TCCTCAAGTCCCTTGGCAGCTGG + Intergenic
1101856883 12:108451136-108451158 TGCTGTAGGCCAGAGTCAGCTGG + Intergenic
1101917269 12:108905385-108905407 TCCTGAAGGCAATTTGCAACTGG + Intergenic
1101989059 12:109469543-109469565 TGCTGAAGGCCATGTTCAGCGGG - Exonic
1102203463 12:111074534-111074556 AGCTGAAGGCCACAGGCAGAGGG - Intronic
1103344062 12:120237771-120237793 TGCTGAGGCCCCTTGACAGCTGG + Intronic
1103350010 12:120277631-120277653 TGCTGAAGGCCGAAGGCCGCAGG - Intergenic
1103776913 12:123372691-123372713 TGCTGAAGGCCGAAGGCCGCAGG + Intergenic
1104323466 12:127773783-127773805 TGCTGCAGGCGATGGCCAGCTGG - Intergenic
1108570325 13:51743326-51743348 GGCTGCAGGCCATTGGCAGAAGG - Intronic
1109671269 13:65611655-65611677 GCCTGAAGGCCATTGACAGGTGG + Intergenic
1113194735 13:107788829-107788851 TGCTGAAGGATAGTGGCAACCGG + Intronic
1114454451 14:22846082-22846104 CTCTGAAGGCCAGTGGCAGCAGG + Exonic
1117328688 14:54691504-54691526 TGCTGAAGTCCTTGGGCAGTGGG - Intronic
1118471265 14:66077302-66077324 GGATGAAGGTCATTGGCAGTGGG - Intergenic
1119840690 14:77790688-77790710 TCCTGAAGCCCATTGACAGCTGG + Intergenic
1122008571 14:98726958-98726980 AGCTGAAGGAGACTGGCAGCAGG + Intergenic
1122567173 14:102667649-102667671 AACTGAAGGTCAGTGGCAGCAGG + Intronic
1202920899 14_KI270723v1_random:29826-29848 GGCTCAGGGCCATAGGCAGCTGG + Intergenic
1123412611 15:20072880-20072902 GGCTGGAGGTCATTGGCAGGTGG - Intergenic
1123521953 15:21079993-21080015 GGCTGGAGGTCATTGGCAGGTGG - Intergenic
1124173974 15:27404655-27404677 TCCTGAAGGCCAGTGGCGGTGGG - Intronic
1129161201 15:73748875-73748897 AGCTGGGTGCCATTGGCAGCGGG + Intronic
1130111756 15:80971190-80971212 AGCTGAAAGCCATTTACAGCAGG - Intronic
1130406721 15:83609318-83609340 TCGGGAAGGCCATTGACAGCAGG + Intronic
1133343592 16:5055280-5055302 GGCTGGAGGCCATTCTCAGCTGG - Exonic
1134274136 16:12760578-12760600 TGCTGAGGTACATTGTCAGCAGG + Intronic
1136278374 16:29192568-29192590 GGCTGAAGCCCACTGTCAGCAGG + Intergenic
1137723726 16:50642929-50642951 TACTGAAGGCCAGAGACAGCAGG - Intergenic
1137906907 16:52332544-52332566 TGCTTAAGCCAATTTGCAGCTGG - Intergenic
1138345542 16:56317982-56318004 TGCTGCAGGCATTTGGCGGCTGG - Intronic
1139991326 16:70941715-70941737 TGCTGAAGGCCATTGGCAGCCGG - Exonic
1141533028 16:84659815-84659837 TGCTGGTGGCCATCGGCGGCCGG + Exonic
1143315052 17:6026260-6026282 TGCTCCAGGCCATAGGCAGAAGG - Intronic
1144685214 17:17221604-17221626 TCCTGAAGGCGTGTGGCAGCCGG - Exonic
1147860840 17:43522091-43522113 TGCAGAAGGCCATCTGCAGTGGG + Exonic
1148489707 17:48015078-48015100 TGCTGAATCCCTTAGGCAGCTGG - Intergenic
1150139746 17:62717664-62717686 TCCTGAAGGCCACAGGCTGCTGG + Intronic
1151380037 17:73719569-73719591 TGCTCAAGGCCAGTTGCTGCTGG + Intergenic
1203170750 17_GL000205v2_random:146264-146286 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1158223686 18:55178176-55178198 TACTGAAGTCCATTGCCTGCAGG - Intergenic
1160368001 18:78345526-78345548 TGCTGAATGCTGTGGGCAGCAGG + Intergenic
1160738196 19:674331-674353 AGCAGGAGGCCACTGGCAGCTGG + Intergenic
1165686277 19:37823517-37823539 TGCTGAAGGTCATGCACAGCTGG + Intergenic
931452844 2:62382995-62383017 TCCTGTTGGCCATTGGCAGGTGG + Intergenic
932489246 2:72109475-72109497 TGGTGCTGGCCATTGGCAGGAGG - Intergenic
932721542 2:74142230-74142252 GGCTGAAGGCCAGTGGCAAGGGG + Intronic
936913003 2:117612105-117612127 TGCTGAAGGGCAAAGGCACCTGG - Intergenic
937158002 2:119734915-119734937 TGCTGGAGGCCTGTGTCAGCAGG - Intergenic
937892394 2:126948555-126948577 TGCTTTGGGCCATTGTCAGCGGG + Intergenic
938547455 2:132347605-132347627 TGCTGGAGGCCAGTAGCAACTGG + Intergenic
940438444 2:153683952-153683974 TGCTGAAGGACAGTGATAGCTGG - Intergenic
942078517 2:172379318-172379340 TGCTCAAGGCCATAGGAAACTGG - Intergenic
944890756 2:204115066-204115088 TGCTGAAGGAGATTGACATCAGG - Intergenic
945003316 2:205375627-205375649 TGCTCAAAGGCACTGGCAGCAGG + Intronic
948908496 2:240991358-240991380 TGCTGGAGGCCCTAGGCTGCTGG + Intronic
1168780357 20:483965-483987 TGCTGAGCGCCAGCGGCAGCTGG + Exonic
1171876321 20:30580360-30580382 TGCTGGAGGCCAGTAGCAACTGG + Intergenic
1173527639 20:43745175-43745197 TGTTGAAGTCCATTGACAGCTGG + Intergenic
1175311001 20:58011560-58011582 TGCTGAAGGCCATAAGCAGGTGG + Intergenic
1175434001 20:58929567-58929589 GGCTGAAGGTCACTGTCAGCTGG - Intergenic
1176311385 21:5152526-5152548 TGGTGAGGCCCAGTGGCAGCAGG + Intronic
1176326737 21:5508095-5508117 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1176330973 21:5548116-5548138 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1176396784 21:6272835-6272857 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1176401020 21:6312856-6312878 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1176436137 21:6676248-6676270 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1176440373 21:6716269-6716291 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1176460399 21:7003318-7003340 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1176464635 21:7043338-7043360 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1176483960 21:7385096-7385118 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1176488196 21:7425117-7425139 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1177829718 21:26124578-26124600 TACTGAAGGCTTTTAGCAGCAGG - Intronic
1179114294 21:38475820-38475842 TGCTGAGGGGCATGAGCAGCAGG - Intronic
1179333400 21:40427305-40427327 TGCCGAGGGCCATGGTCAGCTGG - Intronic
1179845665 21:44109509-44109531 TGGTGAGGCCCAGTGGCAGCAGG - Intronic
1180320212 22:11313142-11313164 TCCAGCAGGCCAGTGGCAGCAGG + Intergenic
1182497533 22:30720396-30720418 TGGTGCAGGCAATTGGCAGGAGG + Intronic
1182549078 22:31091349-31091371 TGCCGACGGCCACGGGCAGCGGG - Exonic
1182771525 22:32800298-32800320 TGCAAATGGCCATTTGCAGCTGG - Intronic
1184370877 22:44081234-44081256 TGCTGGAAGCCATTGGCCTCTGG - Intronic
1184571520 22:45327996-45328018 TGCTGGAGGCCTTTGGCCGGCGG + Exonic
1184651993 22:45923692-45923714 TGCTGCAGGTCACAGGCAGCAGG + Intronic
950005715 3:9689802-9689824 AGCTCAGGGCCATGGGCAGCAGG - Intronic
950131716 3:10551897-10551919 TGCTGAGGGCCCTAGGGAGCTGG - Intronic
950701979 3:14757230-14757252 TGGTGCAGCACATTGGCAGCAGG + Intronic
951331439 3:21373910-21373932 TTCTGAAGGCAATTTGGAGCAGG + Intergenic
953930060 3:47001399-47001421 TGCTGAAGGCCATGGTAACCAGG + Exonic
954082838 3:48222477-48222499 TGCTGAAGGCCACTGAAGGCTGG - Intergenic
954360074 3:50117306-50117328 TGCTGCAGGCCATGGGCTGGCGG + Exonic
961779727 3:129314640-129314662 TGCTGAAGGCCCCTGGCTCCAGG + Intergenic
962441060 3:135416517-135416539 TGCTGAAGATCAGAGGCAGCAGG - Intergenic
965114443 3:164469862-164469884 TGCTGTAGGCACTTGTCAGCAGG + Intergenic
966249708 3:177850269-177850291 TGCTGAAAGTAATTTGCAGCTGG + Intergenic
968186034 3:196634163-196634185 TGCGGGAGGCCATGGGCAGCAGG + Intergenic
972592711 4:40503285-40503307 TGCTGATGGCCATTAGTAGGTGG + Intronic
973925294 4:55730807-55730829 TGCTGAGGTCCAATGGCACCTGG + Intergenic
975991183 4:80261955-80261977 TGCAAAAGGCCATTGGCCACTGG - Intergenic
976637477 4:87301263-87301285 TCCTGAATGCCATTGGCAAGCGG - Intergenic
980134793 4:128848595-128848617 TGCTGGAGGCCATTAGAACCAGG - Intronic
980408565 4:132384659-132384681 TGCTCATAGCCATTGGAAGCTGG + Intergenic
981298528 4:143160553-143160575 TGCTAAGGGCCAATGGCAGATGG - Intergenic
981917771 4:150053565-150053587 TGCTGAAGGTCATTTGTATCAGG + Intergenic
984642053 4:182177433-182177455 GGCTGAAGACCAAGGGCAGCGGG - Intronic
985450276 4:190058070-190058092 GGCTCAGGGCCATAGGCAGCCGG + Intergenic
988900561 5:35727903-35727925 TCCTGAAGGCCTTTTACAGCAGG + Intronic
988947494 5:36220845-36220867 TGGTGCTGGCCATTGGCAGGAGG + Intronic
989738494 5:44738904-44738926 TGAAGAACGTCATTGGCAGCTGG - Intergenic
992228817 5:74643502-74643524 TCCTGTAGGCCCTTGGGAGCAGG + Intronic
992847417 5:80765123-80765145 TGTTGAAAGCCAGAGGCAGCAGG - Intronic
995413830 5:111887498-111887520 TGCTGAAGTCCATTTGGAGAAGG + Intronic
998101648 5:139439663-139439685 TGCTGCAGGCAGCTGGCAGCTGG - Intronic
999320493 5:150611883-150611905 TGCTCAAGGCCTTTCTCAGCTGG + Intronic
1000016524 5:157282548-157282570 TGCACAAGGCCATTCACAGCAGG - Intronic
1001371923 5:171212890-171212912 TGCTGAAGGCCATCAGAACCTGG - Intronic
1002540768 5:179904953-179904975 GGCTGAAGGCCTTTGACCGCAGG - Intronic
1003333274 6:5147065-5147087 TGCTGGAAGCCATTGGTACCAGG + Intronic
1004335263 6:14758532-14758554 TGGTGTATGCCATTGTCAGCTGG - Intergenic
1005841520 6:29747636-29747658 TGCTGAGGGCCCAAGGCAGCTGG + Intergenic
1005870982 6:29974505-29974527 TGCTGAGGGCCGAAGGCAGCTGG + Intergenic
1005912903 6:30326631-30326653 CGCTGAAGCCCATTGCCCGCAGG - Intronic
1006058943 6:31404950-31404972 TGCTGAGGGCCCAAGGCAGCTGG - Intronic
1006071428 6:31499835-31499857 TGCTGAGGGCCCCAGGCAGCTGG - Intronic
1007211356 6:40195551-40195573 TGCTGGAAGGCAGTGGCAGCTGG + Intergenic
1008496456 6:52138869-52138891 TGCAAAAGGCCTTTGGCAGATGG + Intergenic
1008632434 6:53375466-53375488 TACCGAAGGCCATTTACAGCAGG - Intergenic
1011610539 6:89146387-89146409 CGCGGAAGGCCGTGGGCAGCTGG - Exonic
1012893243 6:104920637-104920659 TACTGGGGGCCAGTGGCAGCGGG + Intergenic
1018672783 6:166193452-166193474 TGCTGGAGGCTGTGGGCAGCCGG + Intergenic
1019040684 6:169101740-169101762 TGCTGAAGGCAAATGGCTTCTGG - Intergenic
1020174190 7:5869267-5869289 TCCCCAAGGCCATTGGCAGCTGG + Intergenic
1020942492 7:14558926-14558948 TGCTGGAGACCAGGGGCAGCTGG - Intronic
1023892482 7:44403204-44403226 TGCTGATGGCCAGTGGTAGATGG - Intronic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG + Intronic
1029084566 7:98001104-98001126 TCCCCAAGGCCATTGGCAGCTGG - Intergenic
1029732617 7:102447896-102447918 AGCTGGAGGCCAGTGGCTGCGGG - Exonic
1034554333 7:151840348-151840370 TGGTGAGGGCCCTTTGCAGCTGG - Intronic
1035628217 8:1089494-1089516 TGCTGAAGGCCTGGGGCAGCAGG - Intergenic
1036573148 8:9999459-9999481 TGCTGATGGCCAGGGGCAGGAGG - Intergenic
1036624078 8:10451458-10451480 TGAAGAAAGTCATTGGCAGCAGG + Intergenic
1037446129 8:18967577-18967599 TGCTGAAGGCCTTTATGAGCTGG + Intronic
1037734569 8:21555930-21555952 TGCTGAAGGTCATTAGGAGGAGG + Intergenic
1039557603 8:38487832-38487854 TGCAGAGAGCCAGTGGCAGCTGG - Intergenic
1039909874 8:41817950-41817972 GGGTGCAGCCCATTGGCAGCTGG - Intronic
1040448256 8:47518521-47518543 TGCTGAAGGCATTGGGAAGCAGG + Intronic
1041183332 8:55271643-55271665 GGCTGATGGCCAGGGGCAGCTGG + Intronic
1042056788 8:64772456-64772478 GTCTCAAGGCCATTGGCTGCAGG - Intronic
1046024490 8:108705875-108705897 TCCTGAATGACATTTGCAGCAGG - Intronic
1047942627 8:129840339-129840361 AGCTGAAGGCCATGGGAAGATGG - Exonic
1048574511 8:135680166-135680188 TGTTGGAAGCCATTGCCAGCCGG - Intergenic
1049231976 8:141489197-141489219 TCCTCAAGGCCCTTGGCAGAAGG + Intergenic
1050382596 9:5045576-5045598 TGCAAAAGGCCATTGGGAGTGGG - Intronic
1050588240 9:7135521-7135543 TGCTTAAACCCATGGGCAGCGGG + Intergenic
1053180249 9:35962292-35962314 TGCTTAGGACCAGTGGCAGCTGG + Intergenic
1054821962 9:69531620-69531642 TGCTGAAGGGCAGGGGCAGTGGG - Intronic
1055513952 9:77019140-77019162 TCCTGGAGGCCAGTGACAGCAGG - Intergenic
1057798589 9:98175411-98175433 TGCTGAAGCCCAGTGGGAGTTGG - Intronic
1059463763 9:114452356-114452378 GGCTGACGCCCCTTGGCAGCCGG - Intronic
1059636340 9:116174537-116174559 TGCTGAAGAGCATTGGGAGGAGG - Intronic
1061003444 9:127915558-127915580 TGCCAAAGGCCATTGGAACCAGG + Intronic
1061594360 9:131619365-131619387 TGCAGATGGCCTTCGGCAGCTGG - Intronic
1062228223 9:135465816-135465838 GGGTGACGGCCATGGGCAGCTGG - Intergenic
1203431127 Un_GL000195v1:92210-92232 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1203435381 Un_GL000195v1:132413-132435 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1203368432 Un_KI270442v1:278896-278918 TCCAGCAGGCCAGTGGCAGCAGG + Intergenic
1187590819 X:20715170-20715192 TGCTGATGGCCATTGAGAGAAGG - Intergenic
1188800124 X:34519048-34519070 TGGTGATGGCTATTGGCAGGAGG + Intergenic
1193393441 X:80956576-80956598 CGCAGAAGGGCATTGGCACCAGG + Intergenic
1196748864 X:119096589-119096611 TGCTGAAACCAATGGGCAGCTGG + Exonic
1198816727 X:140599548-140599570 TGCTGGGGGCAAATGGCAGCAGG - Intergenic