ID: 1139999601

View in Genome Browser
Species Human (GRCh38)
Location 16:71012312-71012334
Sequence CATTACATGCAGATGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 2, 1: 1, 2: 0, 3: 10, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139999595_1139999601 0 Left 1139999595 16:71012289-71012311 CCGGCACTTCCTGCCAGCTTTCT 0: 1
1: 1
2: 7
3: 39
4: 443
Right 1139999601 16:71012312-71012334 CATTACATGCAGATGTGGGAGGG 0: 2
1: 1
2: 0
3: 10
4: 154
1139999593_1139999601 2 Left 1139999593 16:71012287-71012309 CCCCGGCACTTCCTGCCAGCTTT 0: 1
1: 1
2: 1
3: 13
4: 194
Right 1139999601 16:71012312-71012334 CATTACATGCAGATGTGGGAGGG 0: 2
1: 1
2: 0
3: 10
4: 154
1139999596_1139999601 -9 Left 1139999596 16:71012298-71012320 CCTGCCAGCTTTCTCATTACATG 0: 1
1: 0
2: 1
3: 21
4: 193
Right 1139999601 16:71012312-71012334 CATTACATGCAGATGTGGGAGGG 0: 2
1: 1
2: 0
3: 10
4: 154
1139999592_1139999601 6 Left 1139999592 16:71012283-71012305 CCAGCCCCGGCACTTCCTGCCAG 0: 1
1: 1
2: 1
3: 31
4: 424
Right 1139999601 16:71012312-71012334 CATTACATGCAGATGTGGGAGGG 0: 2
1: 1
2: 0
3: 10
4: 154
1139999594_1139999601 1 Left 1139999594 16:71012288-71012310 CCCGGCACTTCCTGCCAGCTTTC 0: 1
1: 1
2: 6
3: 32
4: 343
Right 1139999601 16:71012312-71012334 CATTACATGCAGATGTGGGAGGG 0: 2
1: 1
2: 0
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139999601 Original CRISPR CATTACATGCAGATGTGGGA GGG Intronic
904472083 1:30742248-30742270 CACCACCTGCAGATGTGGGTGGG + Intronic
907576172 1:55527852-55527874 GCCTACATGCAGATGTGGGGTGG - Intergenic
910841327 1:91564924-91564946 CATGACTTACACATGTGGGAAGG + Intergenic
913533401 1:119749052-119749074 TATCACAGGCAGATGTGCGACGG - Intronic
914334018 1:146698937-146698959 CATTACATGCAGATGTGGGAGGG - Intergenic
916347095 1:163805664-163805686 CATTTCATGGAGTTGTGAGAAGG + Intergenic
917734394 1:177907312-177907334 CATTACTTGCAAAAGTGTGATGG - Intergenic
918236764 1:182588767-182588789 CATTACAATCAGATGTGAGGTGG + Intronic
919106964 1:193165749-193165771 AATTTTATGCATATGTGGGAGGG - Intronic
920430222 1:205914195-205914217 AACTGCATGCAGATGTGGAAAGG - Exonic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
1062952953 10:1518507-1518529 CACTACATGCAGATGTTACATGG - Intronic
1063344311 10:5296942-5296964 GACTACAGGCAGATGTGGGGTGG - Intergenic
1063679968 10:8177706-8177728 CATTAAATGAAGATGAGGTAAGG - Intergenic
1066320322 10:34296696-34296718 CAGTACATGCTGATGGTGGATGG + Intronic
1067459416 10:46446388-46446410 CATTCCATGGAGAGGTTGGAGGG + Intergenic
1067627778 10:47938242-47938264 CATTCCATGGAGAGGTTGGAGGG - Intergenic
1067713516 10:48669323-48669345 CCCTACATGCAGAGTTGGGAAGG + Intergenic
1069674496 10:70238041-70238063 CATTTCATGAAGATGAAGGAAGG - Intergenic
1071928468 10:90438218-90438240 CATGGCATGAAGGTGTGGGAGGG + Intergenic
1077693152 11:4367719-4367741 CATTACATGCATATTTGGCTAGG + Exonic
1078728876 11:13957840-13957862 CCTTACATGGAATTGTGGGATGG + Intergenic
1079853670 11:25571970-25571992 CATTTCAGGCAGAAGTGGGTGGG - Intergenic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1084686270 11:70697779-70697801 CATCTCCTGCAGAGGTGGGAGGG - Intronic
1087555547 11:99715353-99715375 GATTCCATGAAGAGGTGGGAAGG - Intronic
1088891379 11:114047393-114047415 AATTACATGCAGATTAGGGGTGG + Intergenic
1091253040 11:134159928-134159950 CAAAACATGCAGATGTGGCCGGG - Exonic
1093279897 12:17180545-17180567 GATTATATGCACATGTAGGATGG - Intergenic
1095484149 12:42666865-42666887 CTTTACATGCAGAAGTGGGCGGG + Intergenic
1098130756 12:67347605-67347627 TAATACCTGCAGGTGTGGGAAGG - Intergenic
1098759398 12:74403989-74404011 GATTACATTCAGCTGTGGGGTGG + Intergenic
1101225349 12:102682662-102682684 CATTGCTTGCAGCTGTGGAATGG + Intergenic
1104386518 12:128355789-128355811 TAAACCATGCAGATGTGGGAGGG - Intronic
1107057268 13:36119928-36119950 CATTACAGGAAGATGGGTGAAGG + Intronic
1107264159 13:38531675-38531697 TATTTCATTCAAATGTGGGAAGG + Intergenic
1111108674 13:83678342-83678364 CATTAAAGGCAGACCTGGGATGG + Intergenic
1116052035 14:39815611-39815633 TATTACATGAAGATGTAAGAAGG - Intergenic
1118524989 14:66630070-66630092 TATTACATCCAGAGGAGGGATGG + Intronic
1124051004 15:26197598-26197620 TATCCCATGCAGATCTGGGAGGG + Intergenic
1124454746 15:29831521-29831543 CTTTACAGACGGATGTGGGAGGG + Intronic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1126247791 15:46529412-46529434 ATTTAAATGCAGATGTGGAATGG + Intergenic
1126695490 15:51322057-51322079 CACCAGATGCTGATGTGGGACGG - Intronic
1127122486 15:55783795-55783817 CTTTTCAAGCAGATCTGGGATGG + Intergenic
1127647963 15:60976321-60976343 CATATTATGCAGATGGGGGATGG - Intronic
1133418273 16:5623641-5623663 CATTACAAGCAGCTGGGGGAAGG - Intergenic
1133693085 16:8235163-8235185 CATTAAATGGGGAGGTGGGAGGG - Intergenic
1134016573 16:10892515-10892537 CATGACATGCAGATGAAGGCTGG - Intronic
1137027216 16:35489035-35489057 CAGGCCATGCAGATCTGGGAGGG + Intergenic
1137524655 16:49224227-49224249 GTTAACATGCAGATGTGGGAAGG - Intergenic
1139364308 16:66424383-66424405 CATGGCATGGAGATGTTGGAAGG - Intergenic
1139393682 16:66622731-66622753 CATGAGAGGCAGGTGTGGGATGG - Intronic
1139999601 16:71012312-71012334 CATTACATGCAGATGTGGGAGGG + Intronic
1140022586 16:71252512-71252534 CATTGCATGCAAATGAGGTAGGG - Intergenic
1140203408 16:72913140-72913162 CATTAGAGGCAGCTGTGTGAAGG - Intronic
1144247225 17:13379024-13379046 CATTTAATCCAGCTGTGGGAAGG + Intergenic
1145399481 17:22519647-22519669 CATCATATGGAGATGTTGGATGG - Intergenic
1150954688 17:69844115-69844137 AGTTACCTGAAGATGTGGGATGG + Intergenic
1151331431 17:73411511-73411533 CACTCCCTCCAGATGTGGGAGGG - Intronic
1152325594 17:79634089-79634111 CATCCCATCCAGAGGTGGGAGGG + Intergenic
1153588327 18:6646737-6646759 CGTAAGATGCAGAGGTGGGAAGG - Intergenic
1153676508 18:7460333-7460355 ATTTACATGCAGTGGTGGGAAGG - Intergenic
1156734257 18:40234105-40234127 AATCAAATGCAGATGTGGAAAGG + Intergenic
1157818911 18:50751235-50751257 CATGAGATGCAGATGAGGCAGGG - Intergenic
1158239602 18:55361684-55361706 CATTACAGGCAGATGTGGGAGGG + Intronic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1158876653 18:61740390-61740412 CATTCCAAGCAGATGTGACAAGG + Intergenic
1159741413 18:72175854-72175876 AATTACATGCAGATGTAGTATGG - Intergenic
1159905873 18:74091790-74091812 CATTAAAGGCAGCTGGGGGAAGG - Intronic
1160288932 18:77572462-77572484 CATGACATGCAGATATGGAGAGG + Intergenic
1161469274 19:4448207-4448229 CATTACCTGCTGAGGTGGGTTGG - Intronic
1165173781 19:33912425-33912447 CATCACATGGGGATGTGTGATGG + Intergenic
1167177474 19:47875251-47875273 AACAACATGCAGATGTGAGAAGG + Intronic
1168401490 19:56088207-56088229 CACTCCACGCAGATGTGGGCCGG + Exonic
1168700780 19:58438245-58438267 CACTGCATGCAGTTGTGGGTTGG - Intronic
925210084 2:2038050-2038072 CATTCCATGCAGACGTAGCATGG + Intronic
925903746 2:8526898-8526920 TAATTCATGCAGATGTGGGCCGG + Intergenic
925967914 2:9083515-9083537 CAATACATGCATGTGTGGGTTGG + Intergenic
926063343 2:9818775-9818797 AATTACCTACAGAGGTGGGAGGG + Intergenic
926275678 2:11401415-11401437 CAATACAAGCAGATGTGTGGTGG + Intergenic
930884978 2:56314993-56315015 CAATAGAAGCAGATGTGGGGAGG - Intronic
934607987 2:95712539-95712561 CATCACATGCTCATGTGAGATGG + Intergenic
936541327 2:113354426-113354448 CATCACATGCTCATGTGAGACGG + Intergenic
941628663 2:167859625-167859647 CATTTCTTCCAGATTTGGGAGGG + Intergenic
941923279 2:170872493-170872515 CCTTCCATGCAGATGTGGCCTGG + Intergenic
942226185 2:173818353-173818375 CATTACAGGCCAATGTAGGAAGG + Intergenic
943945713 2:194060568-194060590 CATTAAATGCAGAGGTGGTGAGG + Intergenic
944421520 2:199536044-199536066 CATTACATACAGATCTGAGTAGG - Intergenic
947263768 2:228253579-228253601 CATTACATTCAGATTTGTCATGG + Intergenic
1169252107 20:4068780-4068802 CAGGACATGCACATGTGGCAAGG + Intergenic
1170128316 20:12989980-12990002 CATTACATACTGATGAGGGTTGG + Intergenic
1171151251 20:22828122-22828144 CATTCCAAGGAGATGAGGGAGGG - Intergenic
1171329307 20:24323636-24323658 CCTTACAGGCAAATTTGGGAGGG + Intergenic
1172508207 20:35479804-35479826 CATTCCATGGAGATGTTGAAAGG + Intronic
1173851163 20:46219152-46219174 GATCACATGCAGATATGGAATGG + Intronic
1176917228 21:14640516-14640538 CCTTACATCAAGATGGGGGAAGG + Intronic
1179793502 21:43768950-43768972 GAGGACATTCAGATGTGGGAAGG + Intergenic
1182203564 22:28599360-28599382 CATTTCTTTCAGATGGGGGAGGG - Intronic
1183268167 22:36843728-36843750 CATAAAATTCAGATGGGGGATGG - Intergenic
1183999367 22:41661156-41661178 CAGTAAATGCAGGTGTTGGAAGG + Intronic
949341247 3:3033331-3033353 CATTTCATTCAGGAGTGGGAGGG + Intronic
949973578 3:9433610-9433632 CAGTACAGGCAGATGTCTGAAGG - Intronic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
953158279 3:40394761-40394783 GGATGCATGCAGATGTGGGAAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957365848 3:79222733-79222755 AACTGCATTCAGATGTGGGATGG - Intronic
961512167 3:127409693-127409715 CCTTCCATGCAGCTGTGGGCTGG - Intergenic
961760176 3:129161456-129161478 CATCACACGCAGACGTGTGATGG + Intergenic
962076822 3:132090877-132090899 CATTGCATGTAGAAGTGGAAGGG - Intronic
964690974 3:159449330-159449352 CAATAAATGCAGAAGAGGGAAGG + Intronic
965618104 3:170615088-170615110 AATAATATGCAGATGTGGCAAGG - Intronic
967275483 3:187770013-187770035 CATTTCAGGCTGATGTGAGAAGG + Intergenic
967507436 3:190268889-190268911 CCTTATATTCAGCTGTGGGATGG + Intergenic
971888933 4:32492286-32492308 CATTGCATACAATTGTGGGAGGG - Intergenic
973793641 4:54401449-54401471 CACTACATGCAAAAGTGAGATGG + Intergenic
973824137 4:54688149-54688171 AATAGCATGCAGATGGGGGAGGG - Intronic
976906022 4:90237306-90237328 CATTAAATGCAGATGACAGAGGG - Intronic
983112155 4:163765065-163765087 CATTAGATGCAGAGTTGGTAAGG - Intronic
986381479 5:7190691-7190713 CATAACAAGCAAATGTGGGTTGG - Intergenic
992582284 5:78192330-78192352 CATTATATGAATTTGTGGGAGGG - Intronic
994661574 5:102660848-102660870 CAATACATGTTGATATGGGAGGG + Intergenic
995180304 5:109224618-109224640 CATTTAATGCAGATGTGGCCAGG + Intergenic
995239276 5:109867655-109867677 CATTACTTGACAATGTGGGATGG + Intronic
996682074 5:126238540-126238562 GAGAACATCCAGATGTGGGATGG - Intergenic
998861052 5:146444851-146444873 CTTGACAGGCAGAGGTGGGAGGG - Intergenic
999890637 5:155975221-155975243 CAATAAATGCACATGTGTGATGG - Intronic
1000366660 5:160497640-160497662 CATTACATTCATATGTAGGTAGG - Intergenic
1000768135 5:165317582-165317604 CAGGACATGCAAATGAGGGAGGG - Intergenic
1001939991 5:175733583-175733605 CATGACGAGCAGAGGTGGGAGGG - Intergenic
1006111280 6:31747187-31747209 CCGTACATGGAGATGGGGGAAGG - Intronic
1010784905 6:79989826-79989848 CATTATGTGCACATGTGGTAGGG - Intergenic
1012202213 6:96420613-96420635 CATTTTATGCATGTGTGGGAAGG - Intergenic
1014789883 6:125660165-125660187 CAATACATGAAGAAGTAGGAGGG - Intergenic
1014997155 6:128162409-128162431 CAACACATGCAGACATGGGAAGG - Intronic
1018452392 6:163921319-163921341 CTTGTCATGCAGAGGTGGGATGG + Intergenic
1018661330 6:166089855-166089877 CATTTCATGAACATTTGGGATGG - Intergenic
1018673482 6:166198667-166198689 CAATACATGCATATTTGGTAGGG + Intergenic
1019117273 6:169775097-169775119 CAGTACATTCAGATGGGGGAAGG - Intronic
1019978563 7:4604576-4604598 AATTCCTTGCAGTTGTGGGAAGG - Intergenic
1020792553 7:12644431-12644453 CATTAGTTGCAGAGGTGGGTGGG + Intronic
1021456401 7:20833681-20833703 TATTACATGTAGATGTGATAAGG - Intergenic
1027926203 7:84466996-84467018 CATCACATGCAGATGTATGAGGG - Intronic
1028725385 7:94081177-94081199 CACAACATGCTGAGGTGGGAAGG - Intergenic
1030157120 7:106466452-106466474 CAGTGCATGCAGTTCTGGGAAGG + Intergenic
1037484419 8:19334019-19334041 CATCAACTGCAGATGTAGGAAGG + Intronic
1038239466 8:25795372-25795394 ATTTACATGCAGAAGTGGGCAGG + Intergenic
1043285028 8:78517241-78517263 CATTCCATGCATTTGGGGGAAGG - Intronic
1045694670 8:104795034-104795056 CAGTACATGAAAAAGTGGGAGGG - Intronic
1046226427 8:111286224-111286246 GAAGACAGGCAGATGTGGGAAGG - Intergenic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1057037103 9:91818924-91818946 CATGACCTGCAGAAGAGGGAGGG - Intronic
1059371889 9:113847754-113847776 CATTAAATCCAGATGTGGCATGG + Intergenic
1060268323 9:122125142-122125164 CATTACATGCAGATTGGGGTAGG + Intergenic
1061747445 9:132750743-132750765 CGTTAGGTGCAGATTTGGGAGGG - Intronic
1187082143 X:16002120-16002142 CAGTACAAGCACATGAGGGAAGG - Intergenic
1189681704 X:43523693-43523715 AATTACATGAAGAAGTGGCAGGG - Intergenic
1190065725 X:47240627-47240649 CATGACATGCAGCTGTGCGCTGG - Exonic
1190542641 X:51494947-51494969 CACTACATTCAAATATGGGAGGG + Intronic
1194145409 X:90255642-90255664 AAATACAGGCAGATGTGGGAAGG - Intergenic
1195415415 X:104614872-104614894 CATTACATTTATATGTGAGATGG + Intronic
1195724278 X:107898091-107898113 CAGTACATGAAGAACTGGGAGGG - Intronic
1195918659 X:109960387-109960409 CATCACTGGGAGATGTGGGAAGG + Intergenic
1197203320 X:123768049-123768071 CTTTAGAGGCTGATGTGGGAGGG - Intergenic
1197479482 X:126964799-126964821 CTTTACATGGGGATGGGGGAGGG + Intergenic
1200491166 Y:3824940-3824962 AAATACAGGCAGATGTGGGAAGG - Intergenic
1201451182 Y:14116406-14116428 CATTACATGCAGCAATGTGAAGG - Intergenic