ID: 1140000455

View in Genome Browser
Species Human (GRCh38)
Location 16:71020071-71020093
Sequence CTTTCTGAGCTGAAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 392}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140000451_1140000455 -7 Left 1140000451 16:71020055-71020077 CCTGGATCCTTTACATCTTTCTG 0: 2
1: 0
2: 4
3: 17
4: 250
Right 1140000455 16:71020071-71020093 CTTTCTGAGCTGAAGTTGGGTGG 0: 2
1: 0
2: 0
3: 16
4: 392
1140000449_1140000455 5 Left 1140000449 16:71020043-71020065 CCCTGTTTGCTTCCTGGATCCTT 0: 2
1: 0
2: 3
3: 31
4: 361
Right 1140000455 16:71020071-71020093 CTTTCTGAGCTGAAGTTGGGTGG 0: 2
1: 0
2: 0
3: 16
4: 392
1140000450_1140000455 4 Left 1140000450 16:71020044-71020066 CCTGTTTGCTTCCTGGATCCTTT 0: 2
1: 0
2: 2
3: 15
4: 281
Right 1140000455 16:71020071-71020093 CTTTCTGAGCTGAAGTTGGGTGG 0: 2
1: 0
2: 0
3: 16
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140000455 Original CRISPR CTTTCTGAGCTGAAGTTGGG TGG Intronic
900947071 1:5837058-5837080 CTTTCTGAACTAGAGGTGGGCGG + Intergenic
901958897 1:12809094-12809116 CTTTGGGAGCTCAAATTGGGAGG + Intergenic
902251506 1:15156571-15156593 GTTTCTGCTCTGAAGCTGGGAGG + Intronic
903039958 1:20522088-20522110 CTTTGTGAGGTGAAGTTGCAGGG + Intergenic
904763431 1:32821880-32821902 CTTTCGGAGGCTAAGTTGGGCGG - Intronic
906418116 1:45638694-45638716 CTTTGTGAGGTCAAGGTGGGAGG + Intronic
906599495 1:47112674-47112696 CTTTGTGAGGTCAAGGTGGGAGG + Intronic
906647643 1:47487329-47487351 CTTTGTGATGTGGAGTTGGGCGG - Intergenic
907814651 1:57906473-57906495 CTCTCTGAGATGAAGGTGTGTGG + Intronic
913186727 1:116375149-116375171 CTTCCTGAGCTAATTTTGGGGGG + Intronic
914333166 1:146691183-146691205 CTTTCTGAGCTGAAGTTGGGTGG - Intergenic
914999032 1:152571320-152571342 CTTTGGGAGGTGAAGGTGGGTGG + Intronic
915398109 1:155601378-155601400 CTTTGGGAGCTCAAGTCGGGCGG - Intergenic
915413603 1:155722470-155722492 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
917249098 1:173037876-173037898 CTTTGGGAGATCAAGTTGGGTGG + Intergenic
917444047 1:175091831-175091853 CTTTGGGAGGTGAAGCTGGGTGG - Intronic
917800995 1:178570607-178570629 CTTTGGGAGCTGGAGGTGGGAGG - Intergenic
919448383 1:197738926-197738948 CTTCCTGAGATGAGGTTGGAAGG + Intronic
921069878 1:211649913-211649935 CAATTTGAGCAGAAGTTGGGAGG - Intergenic
921403385 1:214751891-214751913 CTTTGGGAGGTGAAGGTGGGCGG - Intergenic
922332826 1:224592719-224592741 TTTTGACAGCTGAAGTTGGGAGG + Intronic
923213918 1:231831834-231831856 CTTTCTGAGAGGTAGTGGGGGGG + Intronic
923269001 1:232337872-232337894 GTTTCTGAGCTCAGGGTGGGTGG - Intergenic
923707697 1:236358112-236358134 CTTTGGGAGGTGAAGTTGGGTGG - Intronic
924257583 1:242197556-242197578 ATATCTGAGCTGAAGCTGGAAGG - Intronic
1063138758 10:3238729-3238751 GTGTCTGAGCTGGAGCTGGGCGG + Intergenic
1063672944 10:8114469-8114491 CTTTCTGGGTTGAGGTTGGGAGG + Intergenic
1064397239 10:14991810-14991832 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1064685863 10:17860519-17860541 CTTTGGGAGTCGAAGTTGGGAGG - Intronic
1064851772 10:19716232-19716254 CAATTTGAGCTGAAGTTTGGTGG - Intronic
1064883347 10:20081795-20081817 CTTTGGGAGGTGAAGGTGGGCGG + Intronic
1065085409 10:22169847-22169869 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
1066060941 10:31723034-31723056 CTTTGTGAGGTCAAGGTGGGAGG + Intergenic
1067670945 10:48320478-48320500 CTTTGGGAGCTCAAGGTGGGAGG - Intronic
1070155636 10:73833204-73833226 CTTTGTGAGGCCAAGTTGGGAGG - Intronic
1071068047 10:81659704-81659726 TTTTGGGAGCTGAAGATGGGTGG + Intergenic
1071489322 10:86125271-86125293 CTCTCTGTGCTGAGGTGGGGAGG - Intronic
1073817042 10:107218937-107218959 CTTTCAGAGGCCAAGTTGGGAGG + Intergenic
1073833494 10:107414053-107414075 CTTTCGGAGCTACAATTGGGTGG - Intergenic
1075883638 10:125877441-125877463 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
1077206024 11:1344829-1344851 CTTTGGGAGGTGAAGGTGGGCGG + Intergenic
1077589047 11:3477663-3477685 CTTTCTGAGCTGAAGTGCCCTGG + Intergenic
1080950370 11:37025342-37025364 TTTTGTTAGCTGAAGTTGAGTGG + Intergenic
1083106602 11:60364353-60364375 CTCTCTGAGCTGGAGATGAGGGG - Intronic
1084244742 11:67849286-67849308 CTTTCTGAGCTGAAGTGCCCTGG + Intergenic
1084261135 11:67979476-67979498 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1084730646 11:71071397-71071419 CTTTCATAGCTGCGGTTGGGTGG - Intronic
1084827943 11:71745270-71745292 CTTTCTGAGCTGAAGTGCCCTGG - Intergenic
1085069081 11:73525530-73525552 CTTTCTCAGCAGAACTTTGGAGG - Intronic
1085625699 11:78070826-78070848 CTTTCTGAGCTGCAGATTAGTGG - Intronic
1088117034 11:106324004-106324026 CTTTAGGAGGTTAAGTTGGGAGG + Intergenic
1088172026 11:107009134-107009156 CATTCAGTGGTGAAGTTGGGTGG - Intronic
1088331872 11:108662990-108663012 CTTTCTGAGGCCAAGGTGGGAGG - Intergenic
1089805105 11:121080058-121080080 CTTTCAGAGGTCAAGGTGGGTGG - Intronic
1090980975 11:131721751-131721773 CTTTCGGAGGTCAAGGTGGGAGG + Intronic
1091079720 11:132654971-132654993 TTTTCTGACCTGAAGCTTGGAGG + Intronic
1091935669 12:4432681-4432703 GATTCTGAGCTGAAGATGGGAGG - Intronic
1092415308 12:8286431-8286453 CTTTCTGAGCTGAAGTGCCCTGG + Intergenic
1092432394 12:8420032-8420054 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1092500405 12:9040546-9040568 ATATCTGAGATGAAGATGGGAGG - Intergenic
1092561801 12:9622536-9622558 CTTTGTGAGGTGGAGGTGGGTGG - Intergenic
1094755423 12:33463116-33463138 CTTGCTGAGCTGAGGTGGGCTGG - Intergenic
1095489503 12:42718319-42718341 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
1097065549 12:56317931-56317953 CTTTGTGAGCCCAAGGTGGGTGG + Intronic
1097070849 12:56353748-56353770 CTTTGGGAGCCCAAGTTGGGTGG + Intronic
1097829897 12:64213149-64213171 CTTTCTGAGCATAAGATGGTTGG - Intronic
1099344866 12:81486710-81486732 TTTTCTAAACTGAAGTTGTGTGG - Intronic
1099411824 12:82339360-82339382 CTTTGGGAGCTGGAGGTGGGAGG - Intronic
1102661121 12:114529444-114529466 CTTTGGGAGGTGAAGGTGGGAGG + Intergenic
1103306898 12:119972317-119972339 CTTTAGGAGCTCAAGGTGGGCGG + Intergenic
1104410104 12:128550727-128550749 CTTTGTGAGATGAATTTTGGAGG + Intronic
1105042743 12:132973720-132973742 CTTTGGGAGGTGAAGGTGGGAGG + Intergenic
1105561660 13:21497996-21498018 CTTTCTGAGGCTAAGGTGGGAGG - Intronic
1106671771 13:31913744-31913766 GGCTCTGAGCTGAAGCTGGGTGG + Intergenic
1107012309 13:35680957-35680979 CTTCATGATCTGAAGTGGGGCGG + Intergenic
1107136550 13:36950827-36950849 CTTTGGGAGCCTAAGTTGGGAGG - Intronic
1107544176 13:41421598-41421620 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1107935858 13:45344877-45344899 CTTTGGGAAGTGAAGTTGGGCGG + Intergenic
1109611318 13:64768329-64768351 CTTTGGGAGGTCAAGTTGGGTGG - Intergenic
1110498103 13:76192687-76192709 CTTTCTGATCAGAAATAGGGTGG + Intergenic
1112025973 13:95411463-95411485 CTGTCTGAGCATAAGGTGGGGGG + Intergenic
1112786573 13:102957830-102957852 CTTTGTGAGGTCGAGTTGGGAGG + Intergenic
1112988010 13:105476292-105476314 CTTTCAGTACTGAAGTTGAGAGG - Intronic
1114712618 14:24793903-24793925 CTTTCTGAGCCAAAGTTAAGAGG - Intergenic
1114851623 14:26389321-26389343 CATTCTGATCTGAAGTTCAGCGG + Intergenic
1115977279 14:39011138-39011160 CTATCTGAGATGCAGGTGGGTGG + Intergenic
1117095009 14:52288344-52288366 ATTTCTGATCTGAGTTTGGGGGG - Intergenic
1117315274 14:54566529-54566551 CTTTCTTTGCTGTCGTTGGGGGG + Intergenic
1118041295 14:61920000-61920022 CTTTCTGAGCATAAATTGAGAGG - Intergenic
1118692655 14:68354623-68354645 CTTTAGGAGACGAAGTTGGGAGG + Intronic
1119813387 14:77543294-77543316 CTTTCTGAGGCCAAGGTGGGCGG - Intronic
1119900052 14:78251823-78251845 TTTTCCCTGCTGAAGTTGGGAGG + Intronic
1121084880 14:91138246-91138268 CTTTGGGAGGTGAAGGTGGGTGG + Intronic
1121400110 14:93668599-93668621 CTTTGGGAGGTGAAGGTGGGTGG + Intronic
1121834019 14:97076091-97076113 CTTTGGGAGGTCAAGTTGGGAGG - Intergenic
1121857637 14:97284518-97284540 CTTTGGGAGGTGAAGGTGGGTGG - Intergenic
1122199217 14:100112127-100112149 CTATATGAGCTGAAGCTGGCAGG - Intronic
1122752470 14:103948258-103948280 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1124059517 15:26276651-26276673 CTTTAGGAGGTGGAGTTGGGAGG + Intergenic
1125012922 15:34899612-34899634 CTTTGGGAGGTGAAGTTGGGAGG - Intronic
1126744792 15:51815016-51815038 CTTTGGGAGGTGAAGGTGGGTGG + Exonic
1127913984 15:63440470-63440492 CTTTCTGGGCTGGTGGTGGGTGG - Intergenic
1128590618 15:68893363-68893385 GTTTCTAAGCAGAAGTTGGATGG + Intronic
1128738727 15:70068835-70068857 CATTCTGACCTGAAGTGGGAGGG - Intronic
1128866459 15:71118336-71118358 ATTTCTGAGCTGGGGATGGGAGG - Intronic
1129764881 15:78157904-78157926 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1132059150 15:98677178-98677200 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1133324783 16:4936272-4936294 GGTTCTGAGCGGAGGTTGGGCGG - Intronic
1133824762 16:9268132-9268154 GTATTTGAGCTGAAGTTGGAAGG + Intergenic
1134333556 16:13272469-13272491 CTTTCTGAGGTCGAGGTGGGAGG - Intergenic
1134650539 16:15905008-15905030 CTTTCGGAGGTAAAGGTGGGTGG + Intergenic
1135000438 16:18772348-18772370 CCTGCTGATCTGGAGTTGGGGGG + Intergenic
1135030386 16:19033436-19033458 CTTTCTGAGTACAAGGTGGGTGG + Intronic
1135538446 16:23312211-23312233 CTTTGTGAGCTCGAGGTGGGAGG - Intronic
1135828135 16:25748452-25748474 CTCTCTGAGCTGCAGGTGTGGGG - Intronic
1136161861 16:28425278-28425300 CTTTGGGAGGTGAAGGTGGGTGG - Intergenic
1136201105 16:28689710-28689732 CTTTGGGAGGTGAAGGTGGGTGG + Intronic
1136217448 16:28803896-28803918 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
1136931099 16:34418552-34418574 CTTTGGGAGTTGAAGGTGGGAGG - Intergenic
1136973474 16:34993256-34993278 CTTTGGGAGTTGAAGGTGGGAGG + Intergenic
1137669530 16:50271348-50271370 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1138084428 16:54120777-54120799 CTTTCTGGGCTCAAATTTGGAGG - Exonic
1138823971 16:60296147-60296169 CTTTTTGAGTCAAAGTTGGGAGG + Intergenic
1140000455 16:71020071-71020093 CTTTCTGAGCTGAAGTTGGGTGG + Intronic
1140229814 16:73108510-73108532 CTTTGTGAGGTCAAGGTGGGAGG - Intergenic
1140809843 16:78566553-78566575 CTGTCTGTGCTGAGGCTGGGAGG + Intronic
1140956522 16:79871427-79871449 CCTTCTGAGCAGAGGTTGTGAGG + Intergenic
1141574305 16:84954272-84954294 CTTTCTGAGCTGCGGTCGGAGGG + Intergenic
1141839545 16:86566005-86566027 GTTTCGAAGCTGAAGTTGGTAGG + Intergenic
1143168364 17:4910683-4910705 CTTTGTGAGGTCAAGGTGGGAGG + Intergenic
1143370676 17:6437087-6437109 CCTTCTCAGGGGAAGTTGGGAGG + Intergenic
1143598606 17:7929967-7929989 TTTTCTGAGCGGAATTGGGGAGG + Intronic
1143996108 17:11007911-11007933 CAGCCTGTGCTGAAGTTGGGAGG + Intergenic
1146542213 17:33706465-33706487 CTTTGGGAGGTGAAGGTGGGTGG - Intronic
1147253376 17:39166603-39166625 CTTTCTTTGCTTAAGCTGGGGGG + Intronic
1147670746 17:42175524-42175546 GATGCTGTGCTGAAGTTGGGAGG + Intronic
1148113673 17:45162165-45162187 CTTTCTGAGAGGAAGGAGGGAGG + Intronic
1148591983 17:48823305-48823327 CTTTGGGAGGTGAAGGTGGGAGG - Intergenic
1148812056 17:50299625-50299647 CTTTGGGAGGTGAAGGTGGGAGG - Intergenic
1148925191 17:51078036-51078058 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1149237193 17:54606291-54606313 TTTTCAGAGATGAAATTGGGAGG - Intergenic
1149823828 17:59808198-59808220 CTTTCTGGGCTGCAGTTTTGTGG + Intronic
1149925981 17:60702832-60702854 CTTTGGGAGATGAAGGTGGGCGG - Intronic
1150077155 17:62202298-62202320 CTTTCTGAGCCTGAGGTGGGAGG + Intergenic
1150353057 17:64460587-64460609 CTTTCGGAGATCAAGGTGGGAGG - Intronic
1151060140 17:71082159-71082181 CCTTCTGGCCTGAAGTTCGGTGG - Intergenic
1153068442 18:1076494-1076516 CTTTCGGAGGTGGAGGTGGGAGG + Intergenic
1153843511 18:9028297-9028319 CTTGCTGTCCTGAAGATGGGAGG - Intergenic
1154330110 18:13422451-13422473 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
1155889780 18:31253213-31253235 CTTTCTGTGTTGCATTTGGGTGG - Intergenic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1156862199 18:41850726-41850748 ATTCCTGAGCTGAATTTGTGGGG - Intergenic
1157033511 18:43942907-43942929 CTTTGTGAGCTTGAGGTGGGCGG + Intergenic
1157283857 18:46363792-46363814 CTTTCTGAGCAGAATTGAGGTGG + Intronic
1157770750 18:50343766-50343788 CTTTGTGAGCCTGAGTTGGGTGG - Intergenic
1158064481 18:53389165-53389187 CTTTCTCAGCAAAAGTTTGGAGG + Intronic
1158163579 18:54513942-54513964 CTTTCTGAGATGAAATTCTGAGG - Intergenic
1158769038 18:60492335-60492357 CTTTCTCATCTAAACTTGGGAGG - Intergenic
1159580420 18:70229498-70229520 CTTTAGGAGGTGAAGGTGGGAGG + Intergenic
1160098037 18:75893587-75893609 CATGCTGAGTTGGAGTTGGGTGG + Intergenic
1160989056 19:1853178-1853200 GTCTCTGAGCTGAACTTGGGTGG - Exonic
1162010911 19:7814347-7814369 CATTCAGAGCTGATGTTGGAGGG - Intergenic
1162077511 19:8197864-8197886 CTTTGGGAGGTGAAGGTGGGCGG + Intronic
1162305017 19:9867125-9867147 CTTTGGGAGGTGAAGGTGGGCGG + Intronic
1162398061 19:10429579-10429601 CTTTGGGAGGTGAAGGTGGGCGG - Intronic
1163147657 19:15392075-15392097 CTTTAGGAGGTGAAGGTGGGAGG - Intronic
1164221717 19:23200783-23200805 CTTTGTGAGCTCCAGGTGGGTGG + Intergenic
1164853774 19:31504989-31505011 CTTTGGGAGGTGAAGGTGGGCGG - Intergenic
1164973562 19:32552947-32552969 CTTTGAGAGGTGAAGGTGGGAGG + Intergenic
1166980547 19:46629714-46629736 CTTTGTGAGGCCAAGTTGGGCGG - Intergenic
1167458142 19:49609355-49609377 CTTTCGGAGGTCAAGGTGGGTGG + Intronic
1167946050 19:52989991-52990013 CTTTCAGAGGTCAAGGTGGGTGG + Intergenic
1168281291 19:55306820-55306842 CTCTCTCCTCTGAAGTTGGGAGG - Intronic
925628118 2:5862396-5862418 CTTGCTGAGCTGTAGGTGGCAGG + Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
928081403 2:28315734-28315756 CTTTGTGAGGTCAAGATGGGAGG - Intronic
929087586 2:38183640-38183662 CTTTGGGAGGTCAAGTTGGGAGG - Intergenic
929663162 2:43810151-43810173 CATTCTCAGCTGTAGCTGGGAGG + Intergenic
929683002 2:44010338-44010360 CTGTCTGAGCTGTGGTTTGGTGG + Intergenic
931429361 2:62196592-62196614 CCCTCTGGGCTGAGGTTGGGTGG - Intronic
931521187 2:63099016-63099038 TTTTCTGAGCTACAGTTTGGTGG + Intergenic
932106471 2:68947831-68947853 CTTTGGGAGCTCAAGGTGGGTGG - Intronic
933749292 2:85592862-85592884 CTTACTGAGATGGGGTTGGGAGG + Intronic
933919506 2:87030498-87030520 CTTTCTGCCCTCATGTTGGGTGG - Intergenic
933966673 2:87435623-87435645 CTTCCTGACCTGTACTTGGGAGG - Intergenic
934003488 2:87739404-87739426 CTTTCTGCCCTCATGTTGGGTGG + Intergenic
934100455 2:88648395-88648417 CTTTCGGAGGTGGAGGTGGGAGG + Intergenic
935558298 2:104534837-104534859 CTTTGTGAGGTCAAGGTGGGTGG + Intergenic
936327120 2:111514864-111514886 CTTCCTGACCTGTACTTGGGAGG + Intergenic
937180168 2:119988251-119988273 CTTTGGGAGCCCAAGTTGGGAGG + Intergenic
937208033 2:120249274-120249296 CTTTAGGAGGTGAAGGTGGGTGG - Intronic
937341564 2:121094558-121094580 CTTTCAGAGGCCAAGTTGGGCGG + Intergenic
938787216 2:134641481-134641503 CTTTCTGAGCAGAAGTTAAAAGG - Intronic
939306703 2:140421010-140421032 CTTTCAGAGGTCAAGGTGGGTGG + Intronic
939323261 2:140651772-140651794 ACTTCTGAGCTGAAGATTGGAGG + Intronic
940976907 2:159956544-159956566 ATTTCTGTGCTGAAGAAGGGGGG - Exonic
941030687 2:160508385-160508407 CTTTCCGAGCTCAGGATGGGTGG + Intergenic
942707604 2:178794229-178794251 CTTTCTGAGCAAAAGGTGGTCGG - Intronic
943486490 2:188491039-188491061 CTTTGGGAGGTCAAGTTGGGTGG - Intronic
943556376 2:189410324-189410346 CTTTCAGAGGCCAAGTTGGGAGG + Intergenic
943797949 2:192021795-192021817 CTGTGTGAGCTGAAGTAAGGAGG + Intronic
944699730 2:202236049-202236071 CTTTGGGAGGTCAAGTTGGGTGG - Intronic
944722478 2:202438068-202438090 CTTTGGGAGGTGAAGGTGGGCGG + Intronic
944803167 2:203256210-203256232 CTTTGCGAGATGAAGGTGGGAGG - Intronic
945167085 2:206957683-206957705 CTTTCAGAGCGGTAGGTGGGTGG - Intronic
946049850 2:216853449-216853471 CTTTGTGAGGCCAAGTTGGGTGG + Intergenic
946287099 2:218711993-218712015 CTTTCTGAGCACAAAGTGGGTGG - Intronic
946948541 2:224847696-224847718 CTTTCTGTCCTGAATTTGTGGGG + Intronic
947610169 2:231520203-231520225 CTTTTTCTGCTGAAGTTGGCTGG - Intergenic
948337456 2:237221598-237221620 CCTTCTGAGCAGAGCTTGGGTGG - Intergenic
948866121 2:240775724-240775746 CTTTCTGGGCTGAGGCTGGGAGG - Intronic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1169801710 20:9517701-9517723 CTTTCAGAGGTCAAGGTGGGAGG - Intronic
1170321038 20:15098333-15098355 CTTTCTCACCTGAATTTGGGTGG + Intronic
1171218029 20:23366250-23366272 GTTTCTGAGCTGCAGGTGTGTGG + Intronic
1171509820 20:25672844-25672866 CTTTCTGATGCCAAGTTGGGTGG - Intergenic
1172083919 20:32363709-32363731 CTTTCTGAGCTGAATCTTGAAGG + Intronic
1172632169 20:36385884-36385906 CCTCCTGGGCTGAAGTGGGGAGG - Intronic
1172715108 20:36957284-36957306 CTTTGTGAGGTCAAGGTGGGAGG + Intergenic
1173509142 20:43612447-43612469 CTTTCGGAGGTCAAGGTGGGCGG + Intronic
1173520390 20:43695606-43695628 CTTTGTGAGGCCAAGTTGGGAGG + Intronic
1174978483 20:55362846-55362868 CTGTGTGAGCTGTAGCTGGGAGG - Intergenic
1175217059 20:57396844-57396866 CTTTCTGCCCTGAACGTGGGTGG - Intronic
1176929476 21:14790896-14790918 CTTTCGGAGGTCAAGGTGGGAGG - Intergenic
1178621558 21:34181546-34181568 CGTTCTGAGATGAAGCAGGGAGG - Intergenic
1179766659 21:43578787-43578809 GTTTCTGGGCTGAAGCTGTGTGG + Intronic
1180556531 22:16582551-16582573 CTTTCTGAGCTGAATGGGTGAGG + Intergenic
1181110122 22:20597581-20597603 CTTTGTGAGGTCAAGGTGGGTGG - Intergenic
1181526696 22:23493603-23493625 ATTTCTGAGCTTAAATTGGCTGG - Intergenic
1182315912 22:29447139-29447161 CTTTCTGGGGTGAAGGTGGGTGG - Intergenic
1183843609 22:40521739-40521761 CTTTGTGAGGTCAAGGTGGGTGG - Intronic
1184342027 22:43891392-43891414 AATTCTGAGCTGGAGTGGGGAGG - Intronic
949571113 3:5294111-5294133 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
949908398 3:8878805-8878827 CATTCTGAGCTGATGTTGATGGG + Exonic
950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG + Intergenic
950315194 3:11995865-11995887 GTGTCTGAGCTGCATTTGGGAGG + Intergenic
951186558 3:19720669-19720691 CTTTAGGAGGTGAAGGTGGGAGG + Intergenic
951198183 3:19847316-19847338 CTTTCAGAGGTCAAGGTGGGAGG + Intergenic
955252323 3:57296471-57296493 CTTTATGAGATGAAGTTGTCTGG - Intronic
955587506 3:60497007-60497029 TTTACTGACCTGAAGTTGGTAGG - Intronic
956765863 3:72483996-72484018 CTTTCGGAGGCCAAGTTGGGGGG - Intergenic
956783474 3:72623188-72623210 CTTTCAGAGCTGAACTTGTTAGG - Intergenic
957044406 3:75362854-75362876 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
957076203 3:75605037-75605059 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
959336810 3:105077615-105077637 CTCTCTGAGCTGAAGGGGTGGGG - Intergenic
960985157 3:123274289-123274311 CTTTGGGAGCTCAAGGTGGGTGG + Intergenic
961275099 3:125720145-125720167 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961876399 3:130026888-130026910 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
961892856 3:130145045-130145067 CTTTCTGAGCTGAAGTGCCCTGG + Intergenic
962463983 3:135639745-135639767 CTTTCTGAGCTGCAGTAGTCTGG + Intergenic
962767800 3:138581458-138581480 CTTTGAGAGGTGAAGGTGGGTGG + Intronic
962959383 3:140296188-140296210 CTTTCTGTTCTGAAGTTGTCTGG + Intronic
963153229 3:142069155-142069177 CTTTCGGAGGTCAAGTCGGGTGG - Intronic
964234364 3:154507529-154507551 CTTTGAGAGGTGAAGGTGGGAGG - Intergenic
964320668 3:155493627-155493649 CTTTGTGAGGTCAAGGTGGGCGG - Intronic
964372993 3:156020560-156020582 TTTTTATAGCTGAAGTTGGGGGG - Intergenic
964703068 3:159590330-159590352 CTTTCAGAGGCGAAGGTGGGAGG + Intronic
964732304 3:159880278-159880300 CTTGGTGAACTGAGGTTGGGCGG - Intronic
965572078 3:170182712-170182734 CTTTGGGAAGTGAAGTTGGGAGG + Intergenic
966892869 3:184419760-184419782 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
968141841 3:196264517-196264539 ATTTCTGAGCTGAACTTTGAAGG - Intronic
968324343 3:197799621-197799643 CTTTGTGAGGTCAAGATGGGTGG + Intronic
968988672 4:3894094-3894116 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
969659209 4:8516534-8516556 CTTTCGGAGGTCAAGGTGGGAGG + Intergenic
969729462 4:8945428-8945450 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
969793788 4:9510135-9510157 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
971386687 4:26147060-26147082 CTTTCTGAGCCGAGGTGAGGAGG + Intergenic
973619460 4:52712506-52712528 CTTTGTCAGCTGGAGTTGCGCGG + Intergenic
974365811 4:60947301-60947323 CTTTGGGAGGTGAAGATGGGAGG - Intergenic
975066670 4:70074874-70074896 CTTAGAGAGCTGAAGTTGGAAGG - Intergenic
976879266 4:89898778-89898800 CCTTCTCAGGTGAAGTTAGGTGG + Intronic
977172390 4:93779499-93779521 CTTTCTCAGGAGAAGCTGGGTGG - Intergenic
979236098 4:118402018-118402040 CTTTGTGAGGTCAAGGTGGGTGG + Intergenic
979496966 4:121394441-121394463 CTTTGTGGCCTGAATTTGGGAGG + Intergenic
980186223 4:129464293-129464315 CTTTGGGAGGTGAAGGTGGGAGG - Intergenic
980877427 4:138676174-138676196 ATTTATGTGCTGAGGTTGGGTGG - Intergenic
980976101 4:139611921-139611943 CTTTGGGAGGTCAAGTTGGGAGG + Intergenic
981552302 4:145954357-145954379 CTTCCTGTGCTGAATTTGAGAGG - Intergenic
981557653 4:146012803-146012825 CTTTCTGAGGTCAAGGTGGGTGG - Intergenic
981938038 4:150255065-150255087 CTTTCTAAGATGAACTTGGGTGG - Intronic
982854560 4:160364393-160364415 TTTTAAGAGCTGGAGTTGGGAGG - Intergenic
983250158 4:165334904-165334926 ATTTCTGATCTGCAGTTGGTTGG - Intronic
985342635 4:188971822-188971844 CTTTGGGAGGTCAAGTTGGGCGG - Intergenic
988912748 5:35861240-35861262 AATTCTGATATGAAGTTGGGAGG - Intronic
990874095 5:60464856-60464878 CTTTCGGAGGTCAAGGTGGGAGG + Intronic
995374032 5:111453469-111453491 CTTTCTGAGAATAAGTTGGTGGG + Intronic
995717793 5:115097309-115097331 CTTTCTGAGGCCAAGGTGGGTGG - Intergenic
997583637 5:135032031-135032053 CTGTCTGGGCTGCAGTTGGTGGG - Intronic
997932850 5:138086459-138086481 CTTTGGGAGGTTAAGTTGGGTGG - Intronic
998034521 5:138903292-138903314 GTTTATGTGCTTAAGTTGGGCGG + Intronic
998278365 5:140780793-140780815 CTTTGGGAGGTGAAGGTGGGAGG - Intergenic
999983394 5:156979256-156979278 CTTTGGGAGGTCAAGTTGGGAGG + Intergenic
1000696377 5:164390290-164390312 CTTTCTGAGCTAAAATTTAGAGG - Intergenic
1001070860 5:168583741-168583763 CTTTGGGAGGTGAAGGTGGGAGG - Intergenic
1001305242 5:170567651-170567673 CTTTCTGATCAGAAGTTGGATGG + Intronic
1003382119 6:5634565-5634587 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1004719253 6:18251779-18251801 GTTTCTGAGCTGAGATTGTGAGG - Intronic
1004848343 6:19670429-19670451 CTTTCTTAGCTGAAATATGGAGG - Intergenic
1005070371 6:21856810-21856832 CTTTGTGAGCTGAAGATGGAGGG + Intergenic
1005195358 6:23276881-23276903 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
1006355275 6:33552777-33552799 CTTTGGGAGCTCAAGGTGGGTGG - Intergenic
1006892180 6:37438134-37438156 CTTTCGGAGGTCAAGGTGGGCGG + Intronic
1007002929 6:38331613-38331635 CTTTGGGAGGTCAAGTTGGGAGG + Intronic
1007262717 6:40575120-40575142 GTTCCTGAGCAGGAGTTGGGAGG - Intronic
1007289730 6:40776303-40776325 CTTTATGTGTTGAGGTTGGGGGG + Intergenic
1007613668 6:43167376-43167398 CTTTTTGAGGTCAAGGTGGGAGG - Intergenic
1007628610 6:43260230-43260252 CTTTAGGAGGTGAAGATGGGAGG + Intronic
1010726213 6:79336743-79336765 CTTTGGGAGATGAAGGTGGGAGG - Intergenic
1010863766 6:80946902-80946924 CTTTGGGAGATCAAGTTGGGAGG + Intergenic
1011286185 6:85725877-85725899 CTTTCGGAGGCTAAGTTGGGTGG + Intergenic
1013087219 6:106866836-106866858 CTTACTGAGCTGCAGGTGGCGGG + Intergenic
1013501265 6:110754274-110754296 CTTTGTGAGGTGGAGATGGGAGG - Intronic
1013743989 6:113322834-113322856 ATTACTGAGCTGAATTTTGGAGG + Intergenic
1014456471 6:121640648-121640670 CTTGTTGAGGTTAAGTTGGGAGG - Intergenic
1014568650 6:122982014-122982036 CTTTCTGAGCTGTAATAAGGAGG - Intergenic
1015120476 6:129695870-129695892 CCCTCTGAGCTGTAGGTGGGTGG - Intronic
1015296490 6:131599243-131599265 CTTGCTAAGCTGCAGTTGGCTGG - Intronic
1015584471 6:134761193-134761215 CTTTCTGAGGCCAAGGTGGGTGG + Intergenic
1015661886 6:135584758-135584780 CTTTGGGAGGTCAAGTTGGGTGG + Intergenic
1017098538 6:150826880-150826902 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1018127276 6:160693563-160693585 CTTTCTGCCCTCATGTTGGGTGG + Intergenic
1018621084 6:165730506-165730528 CTTTGGGAGCTGGAGGTGGGTGG + Intronic
1019420755 7:949670-949692 CAGTCTAGGCTGAAGTTGGGGGG + Intronic
1020307040 7:6843364-6843386 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1020311516 7:6872208-6872230 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1020323078 7:6954546-6954568 CTTTCTGAGCTGAAGTGCCCTGG + Intergenic
1022981516 7:35609265-35609287 CTTTCTGAGCTGGAGAAGGCAGG - Intergenic
1023910390 7:44551421-44551443 CTTTGGGAGGAGAAGTTGGGAGG + Intergenic
1025173170 7:56779963-56779985 CTTTGGGAGGTGAAGGTGGGAGG + Intergenic
1026041617 7:66872965-66872987 TTTTCTGGGCTGGAGTTGAGTGG + Intergenic
1026183386 7:68061804-68061826 CTTTGTGAGGTCAAGGTGGGAGG + Intergenic
1026362820 7:69618418-69618440 CTTTCTGAGCTGAGTTTGACTGG + Intronic
1026785744 7:73300672-73300694 CTGTCTGAGGAGAGGTTGGGCGG + Intergenic
1027108321 7:75419264-75419286 CTGTCTGAGGAGAGGTTGGGTGG - Intronic
1027387074 7:77669236-77669258 CTTGGGAAGCTGAAGTTGGGGGG + Intergenic
1028185916 7:87785201-87785223 CTTTCTGTGCTGAAATTGCGGGG + Intronic
1029078194 7:97952308-97952330 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1029230449 7:99063531-99063553 CTTTGTGGGGCGAAGTTGGGAGG - Intronic
1029670487 7:102027139-102027161 CTTTGGGAGATGAAGGTGGGCGG + Intronic
1030143478 7:106329313-106329335 CTTGCTGAACTGAATTTTGGTGG - Intergenic
1030608992 7:111668583-111668605 CTTTGTGAGGTTGAGTTGGGAGG - Intergenic
1030644778 7:112047932-112047954 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1031933567 7:127712400-127712422 CTTTGGGAGCTCAAGGTGGGAGG - Intronic
1031965080 7:128021958-128021980 CTTTGTGAGCCCAAGGTGGGCGG + Intronic
1031985277 7:128160395-128160417 ATGTCTGAGCTGAGTTTGGGAGG + Intergenic
1032150790 7:129427781-129427803 CTTCCTGAGCAGACGTTGGCTGG - Exonic
1032269849 7:130394500-130394522 CTTTGCGTGCTGAATTTGGGAGG + Exonic
1032727938 7:134609528-134609550 CTTTGTGAGGTCAAGGTGGGCGG + Intergenic
1035366669 7:158352846-158352868 CTTTCTGAGCTGCAGCTGCCTGG + Intronic
1035863900 8:3060430-3060452 CTTTGTGAGACGAAGGTGGGTGG - Intronic
1036262061 8:7248959-7248981 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1036304529 8:7590599-7590621 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
1036314100 8:7707498-7707520 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1036355382 8:8038591-8038613 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
1036372986 8:8176436-8176458 CTTTCTGAGCTGAAGTGCCCTGG - Intergenic
1036765114 8:11544890-11544912 CTTTCTTGTCTGAAGTTGGGAGG - Intronic
1036816626 8:11907422-11907444 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1036877919 8:12489205-12489227 CTTTCTGAGCTGAAGTGCCCTGG + Intergenic
1036906013 8:12709049-12709071 CTTTCTGAGCTGAAGTGCCCTGG + Intergenic
1037446440 8:18970709-18970731 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
1037852594 8:22344622-22344644 CTTTGTGAGGTCAAGGTGGGAGG + Intronic
1038799114 8:30733244-30733266 CTTTCTGAGCTGAAGTGCCCTGG - Intronic
1039282553 8:36002281-36002303 CTTTGGGAGGTGAAGGTGGGAGG + Intergenic
1039634754 8:39152476-39152498 CTTTGGGAGCCCAAGTTGGGTGG + Intronic
1039814866 8:41084388-41084410 CTTTGGGAGGTCAAGTTGGGAGG + Intergenic
1040976922 8:53203803-53203825 CTTTCTCATCTGAAATTGGATGG + Intergenic
1042254908 8:66792633-66792655 CTTTGGGAGATCAAGTTGGGAGG + Intronic
1042616006 8:70650089-70650111 CTTTGGGAGATGAAGGTGGGAGG - Intronic
1042767127 8:72334827-72334849 CTTTCTGAGGCCAAGGTGGGTGG - Intergenic
1045934654 8:107664781-107664803 CTCTCTGAGGTGAAGTTTGAAGG + Intergenic
1046844646 8:118902281-118902303 CTTTCTGAGCCTAAGCTGGAAGG + Intergenic
1046844652 8:118902315-118902337 CTTTCTGAGCCTAAGCTGGGAGG + Intergenic
1047817746 8:128483381-128483403 CTTTCTGGACTGTAGTGGGGAGG + Intergenic
1047907154 8:129484391-129484413 CTTTATGAGATGAGGGTGGGGGG + Intergenic
1049376358 8:142291202-142291224 CTTTCTGAGATGAGGGTGGTGGG - Intronic
1050170167 9:2807350-2807372 CTTTCGGAGGTCAAGATGGGAGG + Intronic
1050171767 9:2827068-2827090 CTTACTGATCTGAGTTTGGGGGG + Exonic
1050325881 9:4496649-4496671 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
1051719510 9:20021707-20021729 AAATCTGAGCTGAAGTTTGGGGG - Intergenic
1051791460 9:20807804-20807826 CTTTGGGAGGTGAAGGTGGGCGG + Intronic
1051858636 9:21599019-21599041 CTTTCTAAGCTGAAGCTCTGTGG - Intergenic
1052112712 9:24608574-24608596 CTTTTTGAGCTTATGGTGGGCGG + Intergenic
1052114025 9:24626800-24626822 ATGTCTGAACTGAAGCTGGGAGG - Intergenic
1053600084 9:39601922-39601944 GTCCCTGACCTGAAGTTGGGTGG - Intergenic
1054253441 9:62740462-62740484 GTCCCTGACCTGAAGTTGGGTGG + Intergenic
1054464072 9:65482422-65482444 CTTTGGGAGCCCAAGTTGGGCGG + Intergenic
1056865832 9:90226699-90226721 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
1056917187 9:90756203-90756225 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1058436381 9:104967742-104967764 CTTTGGGAGCTCAAGGTGGGTGG + Intergenic
1060817269 9:126641671-126641693 CTTGCTGAGCTGCACTGGGGAGG + Intronic
1060861445 9:126957893-126957915 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
1060869943 9:127031420-127031442 TCTTCTGTGCTGAATTTGGGAGG + Intronic
1061361743 9:130147654-130147676 CTTTGTGAGCCCAAGGTGGGCGG + Intergenic
1062692294 9:137848560-137848582 CTTGCTGAGAGGTAGTTGGGGGG - Intronic
1185992015 X:4901799-4901821 CTTTGGGAGATGAAGGTGGGTGG + Intergenic
1187335754 X:18379936-18379958 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
1190773832 X:53536939-53536961 CTTGCTTAGGTGAAGTGGGGAGG + Intronic
1190794577 X:53729107-53729129 CTTTGGGAGGTGAGGTTGGGGGG - Intergenic
1191737253 X:64399876-64399898 CTTTGTGAGGTGGAGCTGGGAGG - Intergenic
1193468385 X:81872854-81872876 CTTTCTGGGGTGAGGTGGGGTGG - Intergenic
1194053463 X:89101153-89101175 CTTTTTGAGCAGAATATGGGGGG - Intergenic
1195368686 X:104151560-104151582 GTCTCTGACCTGAAGTGGGGTGG - Intronic
1196755943 X:119157354-119157376 CTATTTGAGTTGAAGTGGGGTGG + Intergenic
1197441052 X:126491425-126491447 CTTTCTGGGTTGATTTTGGGAGG - Intergenic
1197779578 X:130146192-130146214 CTTTGGGAGCCCAAGTTGGGAGG + Intronic
1198049186 X:132931941-132931963 CTTTGGGAGCCGAAGGTGGGCGG + Intronic
1198493943 X:137171493-137171515 TTTTCTCAGCTGAATGTGGGGGG + Intergenic
1201852558 Y:18502566-18502588 CTTTCGGAGGTCAAGGTGGGTGG - Intergenic
1201880763 Y:18817818-18817840 CTTTCGGAGGTCAAGGTGGGTGG + Intronic