ID: 1140001239

View in Genome Browser
Species Human (GRCh38)
Location 16:71027329-71027351
Sequence TCTACCAGAGACTTGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140001234_1140001239 28 Left 1140001234 16:71027278-71027300 CCTGCTAAGTGTTAATAGGAGAA 0: 2
1: 0
2: 0
3: 8
4: 100
Right 1140001239 16:71027329-71027351 TCTACCAGAGACTTGCTGGCTGG 0: 2
1: 0
2: 0
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140001239 Original CRISPR TCTACCAGAGACTTGCTGGC TGG Intronic
900979240 1:6036920-6036942 TGCAACAGAGACTGGCTGGCTGG - Intronic
901058369 1:6460203-6460225 TCCACCAGGGCCTGGCTGGCTGG - Exonic
901554638 1:10022049-10022071 TTTTCCAGAGACTTCCTGCCAGG + Intergenic
905457764 1:38100334-38100356 TCTATCAGAGACTTGCCCTCGGG - Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906879800 1:49577470-49577492 TCAGCCAGCTACTTGCTGGCAGG + Intronic
912107863 1:106303600-106303622 CCTAGCAGAGACTTGGTAGCAGG - Intergenic
914332314 1:146683590-146683612 TCTACCAGAGACTTGCTGGCTGG - Intergenic
915244569 1:154547271-154547293 ACTAGCAGAGACTTGCTGGTTGG + Intronic
918042681 1:180922753-180922775 TCTGCCAGAGAATTGCTTGGCGG - Intronic
923519037 1:234721877-234721899 ACTCCCACAGATTTGCTGGCTGG - Intergenic
923533450 1:234829822-234829844 CCTACCATAGACTCGCTGGGAGG + Intergenic
1068823899 10:61411190-61411212 TCCAGCAGTGAGTTGCTGGCGGG + Intronic
1069837909 10:71320657-71320679 TTTAAAATAGACTTGCTGGCTGG + Intronic
1071480096 10:86058629-86058651 TCTGCCAGAGACCTGCGGGAGGG + Intronic
1072590023 10:96820494-96820516 TCTATAAGAGGCTTGATGGCCGG - Intergenic
1077250641 11:1559190-1559212 TCCGCCAGAGGCTTGCCGGCTGG - Intronic
1078746447 11:14120087-14120109 TCTACCATATACTAGCTGGGTGG + Intronic
1081869469 11:46376779-46376801 CCTACCAAAGGCTTGCTGGGTGG + Intronic
1088079519 11:105894316-105894338 TCTACCATACATTTGCTGGATGG + Intronic
1092003844 12:5052379-5052401 CCTACCAGAGAGTTGCTGGAAGG - Intergenic
1092209985 12:6639787-6639809 TCTGCCAGTTACTTGCTGGGTGG - Intronic
1097710339 12:62910813-62910835 TATACCTCAGATTTGCTGGCTGG - Intronic
1101029548 12:100645826-100645848 TCTACCACAGACCTGCTCGGTGG - Intergenic
1102090265 12:110181147-110181169 TCTACCAGATTATTGCTAGCTGG - Intronic
1102331994 12:112041483-112041505 TCTATAAGAGTCTTTCTGGCCGG - Intronic
1104113145 12:125723066-125723088 TGTGGCAGAGACTGGCTGGCTGG + Intergenic
1106898019 13:34326238-34326260 TCAAGCAGAGCCTTGCTGGGTGG - Intergenic
1108406232 13:50105350-50105372 TCTACATAAGATTTGCTGGCTGG + Intronic
1110070461 13:71170096-71170118 TATACAAAAGACTTTCTGGCTGG - Intergenic
1111539421 13:89651233-89651255 TCTCCCAGAGAATTGCTGAATGG - Intergenic
1115475277 14:33807527-33807549 TCTGCCAGTGACATGGTGGCAGG + Intergenic
1117558147 14:56907570-56907592 TCCACCAGATCCTTACTGGCTGG - Intergenic
1121137522 14:91511484-91511506 CCCAACAGAGACTTGCTGGAAGG - Intergenic
1121814258 14:96916905-96916927 TCTGCCACTGACTTGCTGGGTGG + Intronic
1122693340 14:103541670-103541692 TCTGGCAGAGCCTGGCTGGCAGG - Intergenic
1125301765 15:38262375-38262397 TCTACCTGGGAGTTGGTGGCAGG + Intronic
1127486314 15:59421013-59421035 TCTTCAAGAGCCTTCCTGGCCGG - Intronic
1127689349 15:61379449-61379471 TCTACCAGAAGTTTGCTGCCAGG + Intergenic
1128683832 15:69669316-69669338 TCTCCCAGATAGCTGCTGGCAGG - Intergenic
1130514616 15:84616782-84616804 TCTAGAAGAGAGATGCTGGCAGG + Intronic
1131264723 15:90909235-90909257 TCTTCTAGGGGCTTGCTGGCGGG + Intronic
1131287684 15:91075201-91075223 TGTGCCAGAGACTCACTGGCTGG - Intergenic
1132057622 15:98664062-98664084 TCTGCAAGAGACTTCCTGGGAGG + Intronic
1136372340 16:29844304-29844326 TCTCGGAGAGAGTTGCTGGCTGG + Intronic
1136386158 16:29927218-29927240 TCTCCCAGGGACCTGCTGGCAGG - Intergenic
1140001239 16:71027329-71027351 TCTACCAGAGACTTGCTGGCTGG + Intronic
1148389517 17:47260992-47261014 TCTACCTGAAAATTGCTGGGAGG - Intronic
1148573238 17:48687822-48687844 TCTGCCTGAGTCTTCCTGGCAGG + Intergenic
1149516202 17:57282863-57282885 TCTAGAAGAGACTTGCCGTCAGG + Intronic
1156713142 18:39973159-39973181 TCTGCCAGACACTTTCTGCCAGG + Intergenic
1159487778 18:69087398-69087420 TCTACCATAAATTTGCTGGAGGG + Intergenic
1165322505 19:35094786-35094808 TGGAGCAGAGACTTGCTGGAGGG + Intergenic
1165659061 19:37558690-37558712 GATAACAGAGACATGCTGGCTGG - Intronic
1167113039 19:47473073-47473095 TCAAGAAGAGACTTGCAGGCTGG + Intergenic
928160175 2:28916158-28916180 TCTCTCAGAGACTTGTTGACAGG + Intronic
930811483 2:55546410-55546432 TCTTTCAGAAACTTGCAGGCCGG + Intergenic
930874285 2:56196570-56196592 GCTTCCAGATACTAGCTGGCAGG + Intronic
931451282 2:62369608-62369630 TATCCCAGACACTTGGTGGCTGG + Intergenic
933265550 2:80177387-80177409 TCAACCAGCTACTTGGTGGCAGG - Intronic
945742331 2:213678812-213678834 CTTACCAGAGACTTGCTGTTTGG + Intronic
948019017 2:234715055-234715077 GCTAACAGGGACTTGCTGCCAGG - Intergenic
1170142362 20:13137791-13137813 TTTCCCAGAGACTTGCAGACTGG + Intronic
1172763887 20:37340646-37340668 TCACACAGAGAGTTGCTGGCAGG - Intergenic
1173250618 20:41362495-41362517 TGCACCAGAGCCTTGATGGCCGG - Exonic
1174004506 20:47399862-47399884 TCTAGAAGAAACTTCCTGGCCGG + Intergenic
1174502242 20:50993895-50993917 TCTACCACACACTAGCTGGGTGG - Intergenic
1175217967 20:57401351-57401373 TCTAGCTGTGACTTGCTGGGTGG + Intronic
1179996403 21:44976417-44976439 TCAGCCCCAGACTTGCTGGCTGG + Intronic
1183984619 22:41562599-41562621 TCTACTCCAGACTGGCTGGCAGG - Intronic
1184924477 22:47627273-47627295 TAAACCACAGACTTGCAGGCTGG + Intergenic
949558720 3:5183194-5183216 TCTAGCAGAACCTAGCTGGCCGG - Intergenic
951166288 3:19487872-19487894 TCTACCACGGACCTGCTGGGTGG - Intronic
951911105 3:27751615-27751637 TATTCCAGAGACTTGCAGTCAGG + Intergenic
953584029 3:44183850-44183872 GCTTCTAGAGACTTGCAGGCAGG + Intergenic
953729802 3:45437608-45437630 TCTAGGAGAGAGCTGCTGGCTGG + Intronic
953843694 3:46410155-46410177 GCTACCAGGGCCTTGCTGCCAGG + Intronic
954287317 3:49628197-49628219 ACTAATAGAGACTTACTGGCTGG + Intronic
956047784 3:65214855-65214877 TCAACCAGCTACTTGGTGGCAGG + Intergenic
960836948 3:121916494-121916516 TCTACCAGGGAGTTGATGGGAGG + Intronic
964522710 3:157585190-157585212 TCTACCATAGACCTGCTTGGTGG - Intronic
964698545 3:159537318-159537340 TCTACCAGATACCTGTTGCCAGG + Intronic
969978880 4:11133574-11133596 ATTACAAGAGACTTGCAGGCAGG - Intergenic
974109390 4:57509635-57509657 CCTATCAGAGACTGGTTGGCAGG - Intergenic
975937505 4:79599776-79599798 GCTACCAGAGACTTGGTATCTGG + Intergenic
976827162 4:89273759-89273781 TATCACAGAGATTTGCTGGCTGG - Intronic
977171446 4:93767620-93767642 TCTACCAGAGCCTTAAGGGCTGG + Intronic
980685768 4:136225766-136225788 TCTACCATAAACTGGGTGGCTGG + Intergenic
981369601 4:143944794-143944816 TCTCCCAGAGCCTGCCTGGCAGG - Intergenic
981877509 4:149565390-149565412 CCTAACAGAGACTTTGTGGCTGG - Intergenic
991450052 5:66742134-66742156 TCTACCAGTGAGGTGCAGGCAGG + Intronic
994599659 5:101886898-101886920 TCTACCAGAGCCTTGGAGGTTGG - Intergenic
997264864 5:132489698-132489720 TCCTCCAGAGACTGGCTGGGAGG - Intronic
998504289 5:142659694-142659716 TCTTTCAGAGAGTTGCTGGCGGG + Intronic
999006115 5:147981337-147981359 CCTGCCAGACACTTGTTGGCAGG - Intergenic
1007748553 6:44057854-44057876 TGTACCAGAGGCCTGGTGGCAGG + Intergenic
1013759311 6:113498361-113498383 TCTTCCAGGTAGTTGCTGGCAGG + Intergenic
1017715183 6:157205721-157205743 TTTATCTGAGACTTGCTTGCCGG - Intronic
1018944783 6:168339970-168339992 GCTCCCAGGGACTTCCTGGCAGG - Intergenic
1027692611 7:81367511-81367533 TCTACCAGAGTTTTTCTGCCTGG - Intergenic
1029358808 7:100073075-100073097 TCTAGCAGAGAGATGGTGGCAGG + Intronic
1030334926 7:108315582-108315604 TCTACCACAACCTAGCTGGCTGG + Intronic
1031501162 7:122518587-122518609 TGTACTAGAGATTTGCTAGCGGG + Intronic
1032802293 7:135326403-135326425 TCTACTAGAGGCTTGATAGCAGG - Intergenic
1033754011 7:144383118-144383140 CCTTCCAGATACTTGCAGGCTGG - Intergenic
1033802810 7:144920746-144920768 TGTAAAAGAGACATGCTGGCTGG + Intergenic
1036703667 8:11030742-11030764 CCTAGGAGAGACTGGCTGGCTGG - Intronic
1039870990 8:41545198-41545220 TCTTCCTGAGACGTGCTTGCAGG + Intergenic
1043448388 8:80341518-80341540 TCTCCCAGATAGTTTCTGGCAGG - Intergenic
1049380745 8:142314593-142314615 TCTGCCAGCGACTCGCTGGATGG + Intronic
1053469943 9:38339265-38339287 TCAACCACAGCCTTGCTGGCAGG - Intergenic
1054962426 9:70983585-70983607 TCTGGCAGAGACTTGTGGGCAGG + Intronic
1058526624 9:105865571-105865593 TCTAGCAGAGCCTGGCTGGATGG + Intergenic
1061016202 9:127981992-127982014 GCTGCCAGAGACCTGGTGGCTGG + Intergenic
1062549669 9:137080250-137080272 TCTCCCTGAGACTTGCCCGCGGG - Intronic
1186909413 X:14146160-14146182 TCCACCAGAAACTTACTAGCTGG + Intergenic
1188667380 X:32840914-32840936 TCTACAATAGAATTGCTGGGTGG + Intronic
1193036895 X:76960960-76960982 TCTACCAGAGACTAAATGGTTGG - Intergenic