ID: 1140009405

View in Genome Browser
Species Human (GRCh38)
Location 16:71115675-71115697
Sequence AGGTAGTGACCTCCTCCAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 2, 1: 0, 2: 2, 3: 4, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140009405_1140009408 14 Left 1140009405 16:71115675-71115697 CCACTTGGAGGAGGTCACTACCT 0: 2
1: 0
2: 2
3: 4
4: 119
Right 1140009408 16:71115712-71115734 AATGGTCTGTTGATAGAGCTTGG 0: 2
1: 0
2: 0
3: 10
4: 105
1140009405_1140009410 25 Left 1140009405 16:71115675-71115697 CCACTTGGAGGAGGTCACTACCT 0: 2
1: 0
2: 2
3: 4
4: 119
Right 1140009410 16:71115723-71115745 GATAGAGCTTGGCTTCTAGTGGG 0: 2
1: 0
2: 3
3: 25
4: 231
1140009405_1140009409 24 Left 1140009405 16:71115675-71115697 CCACTTGGAGGAGGTCACTACCT 0: 2
1: 0
2: 2
3: 4
4: 119
Right 1140009409 16:71115722-71115744 TGATAGAGCTTGGCTTCTAGTGG 0: 2
1: 0
2: 1
3: 14
4: 209
1140009405_1140009406 -4 Left 1140009405 16:71115675-71115697 CCACTTGGAGGAGGTCACTACCT 0: 2
1: 0
2: 2
3: 4
4: 119
Right 1140009406 16:71115694-71115716 ACCTAAAATGTCGCAGTAAATGG 0: 2
1: 0
2: 1
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140009405 Original CRISPR AGGTAGTGACCTCCTCCAAG TGG (reversed) Exonic
902039781 1:13484214-13484236 AGGCAGTCACCTTCTCAAAGAGG + Intronic
902792560 1:18778924-18778946 AGGTTGTGTCCACCTCCCAGTGG + Intergenic
903214165 1:21834016-21834038 ATGTAGTGGCTTCCTTCAAGGGG - Intronic
905243324 1:36595522-36595544 AGGTATTGATCCCCTCCCAGAGG - Intergenic
905879429 1:41454053-41454075 ATGAAGTCACCTCCTCAAAGTGG + Intergenic
906832465 1:49047679-49047701 GGGTAGTAATGTCCTCCAAGAGG + Intronic
907390819 1:54157138-54157160 CAGTTGTCACCTCCTCCAAGGGG + Intronic
909894002 1:81043075-81043097 AGAGAGTCACCTCATCCAAGGGG + Intergenic
912448761 1:109757266-109757288 AGGATGTTACCTCCTGCAAGGGG + Intronic
913533245 1:119747937-119747959 AAGCAGTGCCCTCCCCCAAGGGG + Intergenic
914324154 1:146595170-146595192 AGGTAGTGACCTCCTCCAAGTGG + Intergenic
923365730 1:233258845-233258867 AGGTAGATACCTCCTGCCAGGGG - Exonic
923546797 1:234929175-234929197 AGGCAGTGACCTCCTCTGACGGG - Intergenic
1064784541 10:18879427-18879449 AAAGATTGACCTCCTCCAAGAGG + Intergenic
1068945475 10:62724745-62724767 AGGTACTGACTTCATCCCAGAGG - Intergenic
1071068358 10:81663534-81663556 AGGAAGAGCCCTCATCCAAGGGG - Intergenic
1075589330 10:123679999-123680021 AGGAAGTGACTTCCTCCATATGG - Intronic
1079012481 11:16840718-16840740 AAATAGTGACCTCCATCAAGAGG - Intronic
1079370534 11:19848344-19848366 AGGTGCTGGCCTCCTGCAAGGGG - Intronic
1082717543 11:56633360-56633382 AGATAGTGACCACCGCCAAGTGG + Intergenic
1084312295 11:68324198-68324220 AGGTAGTCACCTGCTCCACAGGG - Intronic
1084365045 11:68692369-68692391 AGGTAGTGACGTCATCCACCTGG + Intergenic
1084438005 11:69155359-69155381 AGGGAGTGACCTCCTCCCAGCGG - Intergenic
1084756483 11:71242160-71242182 CTGTAGGGACCTCATCCAAGTGG - Intronic
1084954106 11:72682352-72682374 AGGTAGAGACCTCCTGGTAGGGG - Intergenic
1088619813 11:111670805-111670827 AGGCAATAAACTCCTCCAAGGGG + Intronic
1089353341 11:117833817-117833839 AGGTAAGGCCCTCCTCCCAGAGG + Intronic
1094291750 12:28858366-28858388 AGTTGGTCACTTCCTCCAAGGGG - Intergenic
1095126806 12:38488995-38489017 AGGTAGAGACCTAATCCAATAGG + Intergenic
1100091979 12:90983893-90983915 AGATAGTAACCCCCTCCAATGGG - Intronic
1101725080 12:107382189-107382211 AGTAAGTCACCTCCTCCAGGGGG - Intronic
1107926622 13:45269406-45269428 AGGTAGTTACCTCCTCCTAGAGG + Intronic
1110945236 13:81406101-81406123 AGGAAGTGACCTTTTCCACGTGG + Intergenic
1116649604 14:47572649-47572671 AGGTAGAGAGTTCCTCCCAGAGG - Intronic
1119544526 14:75461904-75461926 AGGTAGTAACATCCTGCATGTGG + Intronic
1122632007 14:103111523-103111545 GGGCAGTGCCCTCCTCCATGGGG + Intergenic
1124170353 15:27367167-27367189 AGGTAGTGAGCAGCTCCAGGAGG - Intronic
1124533704 15:30526175-30526197 AGGGAGTGACCACCTTCAAAAGG + Intergenic
1124764951 15:32481469-32481491 AGGGAGTGACCACCTTCAAAAGG - Intergenic
1128506935 15:68278961-68278983 AGGCAGCCACCTCCTCCAAATGG - Intronic
1129107079 15:73317926-73317948 AGGGTGTGACCTCCTCCACCAGG - Intergenic
1130944723 15:88542256-88542278 AGGGAATGACCTCCTCCAGGAGG - Intronic
1134093522 16:11404110-11404132 CAGAAGTCACCTCCTCCAAGAGG + Intronic
1137833761 16:51570569-51570591 AGGTAGTATCCTGCTCCAACAGG - Intergenic
1138007838 16:53354603-53354625 AGGGAGTGACCACCTTCAAAAGG - Intergenic
1138046994 16:53735466-53735488 AGGATGTAGCCTCCTCCAAGAGG - Intronic
1138863880 16:60793299-60793321 AGGTAGAGACCTATTCCAATAGG - Intergenic
1140009405 16:71115675-71115697 AGGTAGTGACCTCCTCCAAGTGG - Exonic
1141912202 16:87067711-87067733 AGGTCGTGTCTTCCTCCTAGAGG + Intergenic
1142568684 17:857774-857796 TGGTAGAGACCTCCTCTAGGTGG + Intronic
1144739583 17:17574150-17574172 AGGGAGTGAGCTCTTCAAAGTGG - Intronic
1146581734 17:34044567-34044589 AAGTTCTGTCCTCCTCCAAGGGG - Intronic
1149546983 17:57511057-57511079 TGGTGGTGACCTCCTCCAAAGGG - Intronic
1151042729 17:70882629-70882651 AGGAACTGACTTCTTCCAAGAGG + Intergenic
1161931441 19:7343265-7343287 CGGTAGGGACCTCCTATAAGTGG - Intergenic
1167775448 19:51551648-51551670 AGGTTGTGCCCACTTCCAAGTGG - Intergenic
926424806 2:12731185-12731207 AGGTGATGACCTCCTGCACGAGG + Intronic
929203264 2:39260660-39260682 AGGTAGAGACTTCAACCAAGTGG - Exonic
932304905 2:70695136-70695158 AGGTAGTGTCCTCCTCTCCGAGG + Intronic
936160943 2:110083767-110083789 AGGTTGTGAAATGCTCCAAGGGG + Intergenic
936183720 2:110287587-110287609 AGGTTGTGAAATGCTCCAAGGGG - Intergenic
939259371 2:139787539-139787561 AGGCAGTGACCTCCTCCTTAAGG - Intergenic
942651554 2:178174220-178174242 TGGCTGTGACCTCCTCCCAGTGG - Intergenic
948430075 2:237913199-237913221 AGGTGGTGACATCCTAGAAGCGG - Intergenic
1170841560 20:19928474-19928496 AGGCGGGGACCTCATCCAAGGGG - Intronic
1174042624 20:47710737-47710759 AGCTAGTGATCCTCTCCAAGGGG - Intronic
1174353464 20:49983604-49983626 AGGAAATGACCTCCTTCAACTGG + Intronic
1174399899 20:50270325-50270347 AGGTGGTGACCTCAGCCCAGGGG - Intergenic
1176168225 20:63685596-63685618 AGGTAGGGGCCACCTCCAGGAGG + Exonic
1176346516 21:5753231-5753253 CGGTAGTGAAGTCCTGCAAGAGG - Intergenic
1176353330 21:5873815-5873837 CGGTAGTGAAGTCCTGCAAGAGG - Intergenic
1176498311 21:7571224-7571246 CGGTAGTGAAGTCCTGCAAGAGG + Intergenic
1176540837 21:8151301-8151323 CGGTAGTGAAGTCCTGCAAGAGG - Intergenic
1176559788 21:8334346-8334368 CGGTAGTGAAGTCCTGCAAGAGG - Intergenic
1177223534 21:18223833-18223855 AGGGAATGATCTCCTCCAATAGG + Intronic
1179611431 21:42554428-42554450 AGGCAGAGACATCCCCCAAGCGG + Intronic
1181809245 22:25393322-25393344 AGGTAGTCACCTGCTCCACAGGG + Intronic
1182369969 22:29803937-29803959 ATGTAGTGCCCACCTCCATGAGG - Intronic
1184420467 22:44379944-44379966 AGGCAGCGACCTCCTGGAAGAGG + Intergenic
1184768291 22:46583847-46583869 GTGTAGTGACCTCCTCCCAAAGG - Intronic
1203245777 22_KI270733v1_random:67719-67741 CGGTAGTGAAGTCCTGCAAGAGG - Intergenic
954672106 3:52296734-52296756 AGGTGTTGGCCTCTTCCAAGGGG + Intergenic
957687902 3:83526760-83526782 AGGTAGAGACCCTCTCAAAGTGG - Intergenic
957930073 3:86866012-86866034 AGGAAGTGGCATCCTCAAAGAGG + Intergenic
959514378 3:107249076-107249098 AGGTAGGGGGCTCCTCCAATGGG - Intergenic
961150708 3:124635329-124635351 AGGTGGTGACCTTATGCAAGTGG - Intronic
962462219 3:135624887-135624909 AGAAAGTGACTTCCTCCATGTGG - Intergenic
963072110 3:141312872-141312894 AGATGGTCACCGCCTCCAAGCGG - Intergenic
965104249 3:164338601-164338623 AGGTAGAGACCTCCTTGAGGAGG - Intergenic
969446053 4:7245210-7245232 AGCTGGTTACCTCCTCCAACAGG + Intronic
970240202 4:14001345-14001367 AGGGACTGACCTCATGCAAGAGG - Intergenic
988656042 5:33212912-33212934 AGATAGGGAACTCCTCCAATCGG - Intergenic
991609339 5:68434617-68434639 AGTCAGCTACCTCCTCCAAGGGG + Intergenic
997691567 5:135830976-135830998 AGGTCGTGACCTCCTGTGAGGGG + Intergenic
1001377968 5:171280993-171281015 AGGTGGTGTTATCCTCCAAGAGG - Intronic
1003117490 6:3292959-3292981 AGGCCGTGCCCTCCTCCCAGCGG - Intronic
1003126016 6:3356403-3356425 TGGCAGCGACCTCATCCAAGGGG + Intronic
1010381856 6:75234373-75234395 AGATGATGGCCTCCTCCAAGAGG + Intergenic
1013598051 6:111678828-111678850 ATGTATTGACCTCCTTCAATAGG - Intronic
1014663014 6:124197383-124197405 GAGAAGTGAGCTCCTCCAAGGGG - Intronic
1016097527 6:140056616-140056638 AGGTTACGACCTCTTCCAAGGGG + Intergenic
1019055767 6:169222251-169222273 AGGTGGTGAACTCCACCACGGGG - Exonic
1022728620 7:33002827-33002849 AGTTAGTTACCTCTTCCAGGAGG - Exonic
1023964124 7:44953144-44953166 AGGTAGTGACTTGCTGCAGGGGG - Intergenic
1024088793 7:45918901-45918923 AGGTAGGGACCTCCTCTGTGAGG - Intronic
1025045025 7:55685162-55685184 AGTTAGTTACCTCTTCCAGGAGG + Intergenic
1026279931 7:68913322-68913344 AGGTACTGTCTTCCTCCAACTGG + Intergenic
1026396766 7:69963322-69963344 AGATGGTCACCTCCTCCAACAGG - Intronic
1027453405 7:78358713-78358735 AGGTAGTGACAGCCACCATGGGG + Intronic
1029363859 7:100105122-100105144 TGGCAATGACCTACTCCAAGGGG - Intronic
1030744391 7:113147461-113147483 AGGTAGGGCCCTAATCCAAGAGG - Intergenic
1032109242 7:129061217-129061239 AGGTAGAGCCCTAATCCAAGAGG - Intergenic
1037823879 8:22149037-22149059 AGGGACTGGCCTTCTCCAAGGGG - Intronic
1038145071 8:24887841-24887863 AGCCACTGACCTCCTCTAAGAGG + Intergenic
1038315516 8:26481362-26481384 AGGCAGTGACCTCATCAACGCGG + Intronic
1039255651 8:35716062-35716084 AGTTAGTGACTTCCTCCAGCAGG + Intronic
1042889893 8:73597373-73597395 AGGTAGTGAGCTACTCCACCCGG - Intronic
1046949159 8:120003433-120003455 AGGTCATGCCCTCCTCCCAGGGG - Intronic
1051607392 9:18928858-18928880 AGTTAGTCACATCCTCCAAGGGG + Exonic
1058950705 9:109901331-109901353 AGATAGTGACAACCTCCACGTGG - Intronic
1059368556 9:113806583-113806605 TTGTAGTGTCCTACTCCAAGGGG - Intergenic
1061194091 9:129098174-129098196 AGGGGGTGCCCGCCTCCAAGGGG - Intronic
1203462114 Un_GL000220v1:50792-50814 CGGTAGTGAAGTCCTGCAAGAGG - Intergenic
1189988337 X:46573478-46573500 AGGCAGTGACCTTCTCCGGGTGG + Intergenic
1193332067 X:80245857-80245879 AGGTAGGGACCATCTCCAAAGGG - Intergenic
1200846231 Y:7834307-7834329 AGGGAAAGACCTCCTCCAGGAGG - Intergenic
1202583759 Y:26405006-26405028 AGGGAGTGACCAGCACCAAGAGG + Intergenic