ID: 1140014042

View in Genome Browser
Species Human (GRCh38)
Location 16:71164799-71164821
Sequence CTAGAAAAAGGTTCCCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 2, 1: 0, 2: 1, 3: 18, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140014042_1140014047 9 Left 1140014042 16:71164799-71164821 CCAAAGGGGGAACCTTTTTCTAG 0: 2
1: 0
2: 1
3: 18
4: 119
Right 1140014047 16:71164831-71164853 AGGCTCCACAAAGACAGCTAAGG 0: 2
1: 0
2: 0
3: 16
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140014042 Original CRISPR CTAGAAAAAGGTTCCCCCTT TGG (reversed) Intronic
906655613 1:47546257-47546279 ACAGAAAAAGGTGCCCCCTATGG - Intergenic
907404707 1:54246876-54246898 GTAGAAACGGGTTCCCTCTTTGG + Intronic
908325115 1:63016177-63016199 GTACAAAAATGATCCCCCTTGGG + Intergenic
908340315 1:63171582-63171604 GGAGAAAAAATTTCCCCCTTGGG + Intergenic
914319481 1:146545282-146545304 CTAGAAAAAGGTTCCCCCTTTGG + Intergenic
916200506 1:162266825-162266847 CTAGAAAAAGGTATCCCCTTGGG - Intronic
921069798 1:211649489-211649511 TTAGAAAAAGGTTCCCAGTGAGG - Intergenic
921677073 1:217988308-217988330 CTACCAAAAGGTGCCCCATTTGG + Intergenic
923680126 1:236112171-236112193 CTACAACAAGGTTCACCCTGTGG + Intergenic
924735381 1:246750856-246750878 CTATAAAAAGATTACCCCTTGGG - Intronic
1063069070 10:2641070-2641092 CTAGAAACAAGTTCCCTCTTAGG - Intergenic
1068946110 10:62730426-62730448 TGAGAAATAGGTTCCTCCTTGGG + Intergenic
1069625421 10:69864958-69864980 CAAGAAACAGGTTCCTCCTGAGG + Intronic
1074369692 10:112889956-112889978 TTGGAAAAAGGTACCGCCTTTGG + Intergenic
1076211381 10:128648331-128648353 ATTGAAAAATGTTGCCCCTTAGG + Intergenic
1078442247 11:11377731-11377753 CCAGAAAAAGCTTTCACCTTGGG + Intronic
1081429944 11:42965897-42965919 CTAGAAAGATATTCTCCCTTGGG + Intergenic
1085403075 11:76246069-76246091 TTAGAAAAAGGTGCCCCATCTGG - Intergenic
1086142181 11:83511678-83511700 TTAGAAAAAGCTTCCCTCTCTGG + Intronic
1090011731 11:123051231-123051253 CTTCAAAAAGGGTGCCCCTTGGG + Intergenic
1091005914 11:131953555-131953577 CTAGAAAAAGCTCCCTCCTTTGG - Intronic
1092088959 12:5788391-5788413 CTAGAAAAAGTGTCCCCAGTAGG + Intronic
1092265371 12:6976722-6976744 CCAAAAAAAAGTTTCCCCTTTGG + Exonic
1092672663 12:10881936-10881958 ATAGAACCATGTTCCCCCTTTGG - Intronic
1093409983 12:18853387-18853409 CTAGAGAAAGCTTCTCCCCTGGG - Intergenic
1097614924 12:61872407-61872429 CTCGAAAAAAATTCGCCCTTAGG + Intronic
1098806634 12:75027799-75027821 CTTGTAAAAGTTTCCCCCCTTGG - Intergenic
1105225611 13:18428790-18428812 CTATAAAAAGATTACCCCTTGGG + Intergenic
1106735513 13:32585105-32585127 CTAGAAAAACCTTTCCTCTTTGG - Intergenic
1114145977 14:19978964-19978986 TTAGTAAAAGATTACCCCTTGGG + Intergenic
1115349430 14:32377594-32377616 CTAGAAAAGGGCTGCCCATTTGG + Intronic
1117331077 14:54712455-54712477 CTAAAAAAAGTTTCCCCCAAAGG - Intronic
1118318387 14:64739061-64739083 GTAGAGAAAGGCTCCCCTTTGGG + Intronic
1118813581 14:69292829-69292851 CTAGAAAAAGGCTGCCCAATGGG - Intronic
1120117588 14:80637925-80637947 CAAGAAAAGGGTTCTCCCTTAGG + Intronic
1120833079 14:89015223-89015245 ATAGAAAAAGATTCTCCCCTAGG - Intergenic
1124507200 15:30288542-30288564 TTAAAAACAGGTTCACCCTTTGG - Intergenic
1124736356 15:32250117-32250139 TTAAAAACAGGTTCACCCTTTGG + Intergenic
1129095663 15:73205027-73205049 CAAGAAAAAGGCTCCCTCTGAGG - Intronic
1130178106 15:81596008-81596030 CTAGAAAAAGGTCACTTCTTTGG + Intergenic
1130261523 15:82357749-82357771 TTAGAAAAAAGTACGCCCTTTGG + Intergenic
1130279712 15:82511262-82511284 TTAGAAAAAAGTACGCCCTTTGG - Intergenic
1130471088 15:84227448-84227470 TTAGAAAAAAGTACGCCCTTTGG - Intergenic
1130478582 15:84342018-84342040 TTAGAAAAAAGTACGCCCTTTGG - Intergenic
1130493188 15:84446113-84446135 TTAGAAAAAAGTACGCCCTTTGG + Intergenic
1130593381 15:85232085-85232107 TTAGAAAAAAGTACGCCCTTTGG - Intergenic
1130613678 15:85383271-85383293 TTAGAAAAAAGTACACCCTTTGG + Intronic
1132598668 16:764413-764435 CCCGAAAAAGATTCACCCTTGGG - Intronic
1135655569 16:24245652-24245674 CTAGAAAAAGGTATCCCCAGTGG - Intergenic
1138064103 16:53922716-53922738 CAAGAGAAAGGTGCCACCTTAGG - Intronic
1138220944 16:55249988-55250010 TGAGAAAAAGGTGCTCCCTTGGG + Intergenic
1140014042 16:71164799-71164821 CTAGAAAAAGGTTCCCCCTTTGG - Intronic
1141166179 16:81662399-81662421 GTAGAAAAAGGTACCCTTTTTGG + Intronic
1146150544 17:30465677-30465699 ATAGAAAAAGGTTCCGATTTAGG - Exonic
1146409114 17:32566798-32566820 CTTGTAAAAGCTTCCCTCTTTGG + Intronic
1150729467 17:67679363-67679385 TTAGAAAAAGGTGCCCCTTCTGG + Intronic
1154363326 18:13683620-13683642 CTAGACAAAGGTTCTCCCAGTGG + Intronic
1154527766 18:15310732-15310754 CTATAAAAAGATTACCCCTTGGG - Intergenic
1156934027 18:42680939-42680961 CTAAAAATAAGTTCCCCCATGGG + Intergenic
1166977611 19:46613910-46613932 CTATAAGTAGTTTCCCCCTTGGG + Intergenic
1168381297 19:55926028-55926050 CTAGGAAAAGGTTCCCACTCGGG - Intronic
925535476 2:4911704-4911726 CAAGCCATAGGTTCCCCCTTTGG - Intergenic
927365881 2:22295721-22295743 CTAGAATAAACTTCTCCCTTAGG - Intergenic
928081887 2:28319272-28319294 CAAAGAAAAGGCTCCCCCTTTGG + Intronic
929966604 2:46541982-46542004 CCAGAAAAAGGATACCCCGTCGG - Intronic
932965270 2:76467074-76467096 ATATAAAATGGTTGCCCCTTGGG + Intergenic
934592834 2:95572274-95572296 CTAGAGAAAAGTTCTCCCTCTGG - Intergenic
936716462 2:115192365-115192387 TTAGTAAAAGATTACCCCTTGGG - Intronic
937556920 2:123169179-123169201 CCAGAAAAAAGTGCCCTCTTGGG - Intergenic
938526862 2:132142189-132142211 CTATAAAAAGATTACCCCTTGGG - Intergenic
940469449 2:154076638-154076660 CAAGAAAAAGGGTCCAACTTTGG - Intronic
940485242 2:154288993-154289015 CTAGCAAGAGGTTCTCCCTGAGG + Intronic
941456916 2:165720125-165720147 CTAACAAAAGGTTCCACGTTTGG - Intergenic
941778603 2:169419917-169419939 CTAAAGAAAGGTTCCCCATGTGG + Intergenic
942737366 2:179130195-179130217 CTAGAGAAAGGATCCCCCCTGGG + Intronic
944513890 2:200491663-200491685 TTAAAAAAATGTTCCCCCGTAGG - Intronic
947009368 2:225548712-225548734 CAAGAAAAAGGTTCTACATTGGG + Intronic
1169036865 20:2460815-2460837 CAAGACAAGGGTTCCCACTTTGG - Intergenic
1173423698 20:42925400-42925422 CTAGAACATGGTTCCTCCTAGGG + Intronic
1173839261 20:46146477-46146499 TTAGAAAAAGGTACCCCCTCTGG - Intergenic
1176769665 21:13057813-13057835 CTATAAAAAGATTACCCCTTGGG + Intergenic
1180516770 22:16151757-16151779 CTATAAAAAGATTACCCCTTGGG + Intergenic
949610024 3:5694400-5694422 CTATAAATAGATTGCCCCTTGGG - Intergenic
950112253 3:10426815-10426837 CTAGAAATAGATTCCTCCTCAGG + Intronic
951148599 3:19259869-19259891 GTAAATAGAGGTTCCCCCTTTGG - Intronic
951580142 3:24154070-24154092 TTAGAAAAATGTTCCTTCTTGGG + Intronic
955157919 3:56435513-56435535 CTATAAAAAGGCCCCTCCTTTGG + Intronic
956686376 3:71832302-71832324 TTAGAAAAAGGTGCCTCTTTGGG + Intergenic
964533378 3:157692658-157692680 CTAGAAAATGTTTCCCCCTAGGG - Intergenic
966221712 3:177557920-177557942 CTGGAATAATCTTCCCCCTTTGG + Intergenic
967025514 3:185560915-185560937 CTAGAAAAAATGTCCTCCTTAGG - Intergenic
970194504 4:13541797-13541819 TTAGAAAAAGGCGCCCCCTCAGG + Exonic
971020642 4:22531673-22531695 CTAGCAAAAGCTTCCTCTTTGGG + Intergenic
973530510 4:51832938-51832960 TTAGAAAAAGGTGATCCCTTTGG + Intergenic
973581189 4:52346045-52346067 CAAGGAACAAGTTCCCCCTTGGG + Intergenic
974082559 4:57227810-57227832 CTAGAAAATGGTACCCAATTTGG - Intergenic
974478647 4:62417216-62417238 ATAGAAAATGTTTCCCTCTTAGG + Intergenic
975508183 4:75162489-75162511 TTAGAAAAAGGTGCCCCTTCTGG - Intergenic
976074996 4:81287925-81287947 AGAGAAAAAGATTCCCACTTAGG + Intergenic
976085022 4:81399068-81399090 CTAGAAAACTGTTTCCACTTTGG + Intergenic
976608113 4:87001607-87001629 CTAGAAATAGATTTGCCCTTAGG + Intronic
986979280 5:13428318-13428340 CAAGAAACAGATTCACCCTTAGG - Intergenic
989591574 5:43117946-43117968 GTAGAAAAGGGTTCTCCATTTGG + Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
996413284 5:123182124-123182146 TTAGAAAAAGATGCCCTCTTTGG - Intronic
998332755 5:141344148-141344170 CTAGATAAAGGTTCCTTCGTGGG + Exonic
999561776 5:152811193-152811215 ATACCAAAAAGTTCCCCCTTGGG - Intergenic
999606531 5:153322996-153323018 CTGGTAGAAGGTTGCCCCTTTGG - Intergenic
1004259245 6:14094112-14094134 CGAGAAAAATCTTCCCTCTTTGG + Intergenic
1008108097 6:47461962-47461984 CTAGACAACTGTTCCCCTTTTGG + Intergenic
1013994351 6:116290827-116290849 CTGGAAAAAGTTTCTCCCTTTGG - Intronic
1016239436 6:141911767-141911789 TTAGAAAAAGGTACCACTTTGGG - Intergenic
1017970313 6:159306661-159306683 CTAGAAAATGGTTCCCTTTTTGG - Intergenic
1018754820 6:166839780-166839802 CCAGAAATGGGTTCTCCCTTGGG + Intronic
1019109740 6:169700295-169700317 CTTGACAAAGTGTCCCCCTTGGG + Intronic
1023142192 7:37112836-37112858 TTAAAAATAGCTTCCCCCTTAGG - Intronic
1027635963 7:80674721-80674743 CTAAAAAAAGGTTTTCCTTTAGG - Intronic
1030090338 7:105852499-105852521 CTAGAAAAAGGCACCCTCTCTGG + Intronic
1035650365 8:1259576-1259598 CTAGAAAAAGAGTCAGCCTTGGG + Intergenic
1036104545 8:5825788-5825810 CTATGAAAAGATTACCCCTTGGG - Intergenic
1037141409 8:15524677-15524699 CTAAAAATAGGTTCTCCATTGGG - Intronic
1037379568 8:18270118-18270140 CTTGGAAAAGGTTTGCCCTTCGG - Intergenic
1038893638 8:31755882-31755904 CTAGAAAAAGATTTTCCCATAGG + Intronic
1040317259 8:46271003-46271025 CTAGAGAAAGGCACCCACTTGGG + Intergenic
1041143498 8:54846918-54846940 CTAGAAAAATGTGTCCCTTTGGG + Intergenic
1042789721 8:72590582-72590604 CTAGAATAAGGTGACACCTTAGG + Intronic
1043328245 8:79080284-79080306 ATAGAGAAAGGTTCTTCCTTGGG + Intergenic
1044078170 8:87849187-87849209 ATAGAAAAAGATCCCACCTTAGG + Intergenic
1049921551 9:369491-369513 TTAGAAAAAGATACCTCCTTGGG - Intronic
1052036366 9:23685650-23685672 GGAGATAAAGGTTCCCCCTCAGG + Intergenic
1053705556 9:40749544-40749566 CTATAAAAAGATTACCCCTTGGG - Intergenic
1054415633 9:64873151-64873173 CTATAAAAAGATTACCCCTTGGG - Intergenic
1058427324 9:104886224-104886246 ATAAAACAAGGTTCCCACTTTGG - Intronic
1060986466 9:127822127-127822149 AGAAAAAAAGGTTGCCCCTTTGG - Intronic
1061666991 9:132166282-132166304 CTGGAAACATGTTCCCTCTTTGG - Intronic
1189734729 X:44058390-44058412 CTTGACAAAGGTGCCCCCTCTGG - Intergenic
1192016650 X:67338748-67338770 CCAGAGAAAGGCTACCCCTTAGG + Intergenic
1192167447 X:68834768-68834790 CTAGAACCAGGCTCCCCCTTTGG + Intronic
1193042478 X:77018020-77018042 CTAGAAAATGGTACTGCCTTGGG + Intergenic
1197832745 X:130662288-130662310 GAAGAAAAAGTTTCCGCCTTTGG - Intronic