ID: 1140016628

View in Genome Browser
Species Human (GRCh38)
Location 16:71193044-71193066
Sequence ATATGCAAAGGACAGAGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140016628 Original CRISPR ATATGCAAAGGACAGAGTTA TGG (reversed) Intronic
904345097 1:29862688-29862710 ATAGCCAATGGACAGAGTGAGGG - Intergenic
904745185 1:32706366-32706388 AGATGAATAGGGCAGAGTTATGG + Intergenic
905213660 1:36391607-36391629 GAAGGCAAAGGGCAGAGTTAAGG + Intronic
905419549 1:37830952-37830974 ATAACCAGAGGACAGAGTTCAGG - Intronic
905872480 1:41413032-41413054 CCTTGCAAAGGACAGAGATAAGG + Intergenic
906931761 1:50177079-50177101 ATTTCCACAGGACAGAGTTTAGG + Exonic
907888710 1:58618079-58618101 ATAGGGAAAGAACAGAGATAGGG - Intergenic
908588228 1:65597827-65597849 ATATGGAGAAAACAGAGTTAAGG + Intronic
908764213 1:67539745-67539767 AGATGCAGAGGACAGACTTCAGG + Intergenic
909711254 1:78651925-78651947 ATATGGAAAGGAAAGATTTAGGG - Intronic
909876871 1:80816786-80816808 ACATCCAAGGGACAGAGCTAAGG - Intergenic
910856144 1:91697908-91697930 ATAAACAAAGGACAGAGGAAAGG + Intronic
916276469 1:162999445-162999467 GTAGGCAAAGGACAGAGAAAGGG - Intergenic
916565273 1:165970360-165970382 AAAAGCAAAGGACAGACTTGAGG - Intergenic
916901187 1:169225437-169225459 AAATGCAGAGGACAGAGGAAAGG + Intronic
916934511 1:169613702-169613724 ATATGGAAAGGTCAGAGTCATGG + Intronic
917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG + Intronic
918509749 1:185298347-185298369 TTAAGCAAAAGACAGATTTAGGG - Intronic
919038329 1:192346449-192346471 ATGTGCAAATGACTTAGTTATGG - Intronic
920942951 1:210501275-210501297 ATCTGCAAAGGGCAGAGGTTGGG - Intronic
923149804 1:231222640-231222662 AGCAGCAAAGGACAGAGTTCAGG - Intergenic
923358302 1:233182456-233182478 CTATACAAAGGACAGAGTGTGGG - Intronic
923981724 1:239332021-239332043 ATTTGCAAAAGACAGTGATATGG + Intergenic
1063340970 10:5262742-5262764 GTGTGCAAAGGACAGAATCAGGG - Intergenic
1064824027 10:19374931-19374953 AGAAGCAAAGGACAGATATAGGG + Intronic
1065315463 10:24459511-24459533 ATATACAAAGCCCAGGGTTAAGG - Intronic
1068517616 10:58044015-58044037 ATAGCCAAAGGACAGAGATTTGG + Intergenic
1069159463 10:65075142-65075164 AAAGGCAAAGGAAATAGTTATGG + Intergenic
1070618239 10:77985996-77986018 ACAAGCCAAGCACAGAGTTAGGG + Intronic
1076337852 10:129720524-129720546 ATATGCTATGGATACAGTTATGG + Intronic
1077726129 11:4676663-4676685 ATTTCAAAAGGAGAGAGTTAGGG + Intergenic
1078118651 11:8482452-8482474 ATATACTAAGGACTGAATTATGG + Intronic
1078119875 11:8496206-8496228 ATATGCAAATTACAGAGGGAAGG + Intronic
1078309239 11:10221901-10221923 AGAATCAAAGGACAGAGTTCAGG + Intronic
1078442944 11:11382409-11382431 ATATACAATGGACAGTGTTTTGG - Intronic
1079670780 11:23168176-23168198 AGATGGAAAGGGCAGAGTTGAGG - Intergenic
1079836979 11:25347823-25347845 ATTTGCAAAGGACTGTTTTATGG + Intergenic
1080001836 11:27359235-27359257 ATAGGCAAAGGGCAGATTCATGG - Intronic
1082221830 11:49648036-49648058 ATATGAAAAGGAGATAGTTTTGG - Intergenic
1086296905 11:85379236-85379258 ATGAGCAAGGGACAGAGCTAGGG - Intronic
1086627201 11:88971123-88971145 ATATGGAAAGGAGATAGTTTTGG + Intronic
1087021081 11:93604015-93604037 AGATGCAAAGGAGAAAGTTCAGG + Intergenic
1087431542 11:98062473-98062495 ATCTGTAAAAGACAGAGGTACGG + Intergenic
1087628668 11:100624806-100624828 ATATACAAAGCCCAGACTTATGG + Intergenic
1088119417 11:106350677-106350699 ATTTTCCAAGGACAGAGTTTGGG + Intergenic
1092922253 12:13243069-13243091 ACAGGCTAAGGAGAGAGTTACGG - Intergenic
1093655142 12:21686224-21686246 CTTTGCTGAGGACAGAGTTAAGG + Intronic
1093878621 12:24378468-24378490 CTATGCCAAGGACAGAGCTAGGG - Intergenic
1094218139 12:27966980-27967002 ACATGCAAGAGACAGGGTTAGGG + Intronic
1095122192 12:38432890-38432912 ATATGAAAGGGAAAAAGTTATGG - Intergenic
1095649897 12:44595227-44595249 ATATTAAAAGGACAAAGTCAAGG + Intronic
1096316572 12:50572407-50572429 ATTTGCTAGGGAGAGAGTTAAGG + Intronic
1096366980 12:51036299-51036321 AGAGCAAAAGGACAGAGTTAAGG - Intergenic
1096427906 12:51519960-51519982 ATATGCAAAGCACAGTGGTGAGG + Intergenic
1098005575 12:65993523-65993545 ATATTCAACTGACAGAGCTAGGG + Intergenic
1098625024 12:72654979-72655001 ATATGCAGAGGACATATTAAGGG - Intronic
1099408116 12:82287478-82287500 ATAGGCAGAGGAGAGTGTTATGG + Intronic
1099629226 12:85119141-85119163 ATAGGCAAAGCACAGATTTTAGG - Intronic
1099890460 12:88583374-88583396 ATATGCAAATGAAAGATTTTGGG + Intergenic
1099938957 12:89162150-89162172 ATCTGCAAAAAACACAGTTAAGG + Intergenic
1100226159 12:92558036-92558058 ATAGGGAAAGGGCAGAATTATGG + Intergenic
1102761066 12:115385677-115385699 ATATGCAAATGACTGAGTCCTGG + Intergenic
1104368648 12:128201802-128201824 GTATGTAGAGGAAAGAGTTAAGG + Intergenic
1106642995 13:31605612-31605634 CTATGCATCAGACAGAGTTAGGG - Intergenic
1106737339 13:32600971-32600993 AAATTCAAAGGAGAGAGCTACGG - Intronic
1107669440 13:42729008-42729030 CTCTCCAAAGCACAGAGTTAGGG - Intergenic
1109618279 13:64865651-64865673 ATCTGCAAAGGAGTAAGTTATGG - Intergenic
1111620340 13:90716836-90716858 ATATGCAAATGAAAGATTTGGGG - Intergenic
1111735745 13:92137384-92137406 AGACGCAAATGACAGAGTCAAGG + Intronic
1113122562 13:106940010-106940032 ATATGCAGAGGACAGAGATGGGG - Intergenic
1113337956 13:109394807-109394829 ATATGCAAAGTTCAGAGAGATGG - Intergenic
1115146608 14:30233922-30233944 ATATTCAAAATACAGAGTTGAGG + Intergenic
1116491791 14:45512477-45512499 ATCTGCAAAAGACACAATTAAGG - Intergenic
1118498029 14:66328141-66328163 AGATGCAAAAGAGAAAGTTATGG - Intergenic
1118675528 14:68180788-68180810 AGATGTACAGGACAGAGTTAGGG + Intronic
1119563444 14:75608867-75608889 ATTTGCAAGGGACAGAGGTCTGG - Intronic
1119901264 14:78262014-78262036 AGATGGAAAGAACAGAGTGAGGG + Intronic
1120633133 14:86915852-86915874 AAATGCAAAGCACAGTGTTTAGG + Intronic
1121280932 14:92697209-92697231 ATCTGCAAAAGACACAGTTAAGG + Intergenic
1121974205 14:98387429-98387451 ATATGAAAATGACAGAGTTTGGG - Intergenic
1123765069 15:23470247-23470269 ACAGGCAAAGAAGAGAGTTATGG - Intergenic
1124101901 15:26703471-26703493 ATGTGAAAAGGACAGCGTTTAGG - Intronic
1124685514 15:31778420-31778442 ATATCCAAAGGAAAGAGAGATGG + Intronic
1125114594 15:36075086-36075108 ATCTGTAAAGGAGAGAGTAAAGG - Intergenic
1125130878 15:36282745-36282767 AAAGGCAAAGGACTGAGTCAAGG + Intergenic
1126538506 15:49795548-49795570 ATATGGAAAGGGCAGAGTCACGG + Intergenic
1127779771 15:62301878-62301900 ATATGAGAAGGACAGGGTGATGG + Intergenic
1128828343 15:70742663-70742685 ATATACAAAGATCATAGTTATGG - Intronic
1130719905 15:86376445-86376467 AGATGCATAGGACAGAGTCCAGG + Intronic
1130845940 15:87745837-87745859 ATCTACAAAGGACAGTATTAGGG - Intergenic
1133870304 16:9679764-9679786 ATACTCAAAGGTCAGAGTTGTGG - Intergenic
1133983899 16:10653320-10653342 GTATGCAAAGCACAGAGTTTGGG - Intronic
1134069809 16:11254150-11254172 GTATGCAAAGCACAGAATTAGGG + Intronic
1135580333 16:23620357-23620379 AGAACCAAAGGACAGAGTTCAGG - Intronic
1137764220 16:50965405-50965427 AAATGCAAAGCACAGAGATGGGG - Intergenic
1139083635 16:63558200-63558222 ATTTGAAATGGACAGAGTCATGG - Intergenic
1139100063 16:63754996-63755018 ATAAGCAAAGGAAAGAATCAGGG + Intergenic
1139453354 16:67050015-67050037 GTATGCAAAGAACAGACTTAGGG - Intronic
1140016628 16:71193044-71193066 ATATGCAAAGGACAGAGTTATGG - Intronic
1140132479 16:72175711-72175733 ATAAGTAAAGGAAAGACTTATGG - Intronic
1140961129 16:79914195-79914217 AAAATCAAAGGACATAGTTATGG + Intergenic
1141554019 16:84825175-84825197 ATATTCAAAGGACAGGGTTTGGG + Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1147603598 17:41761044-41761066 AGACCCAAGGGACAGAGTTATGG - Intronic
1147657925 17:42101523-42101545 ATATGCACTGGATGGAGTTAGGG - Exonic
1148574372 17:48699085-48699107 ATATGCAGAGGAAATATTTAAGG - Intergenic
1149164758 17:53737896-53737918 ACATGAAAAGGAAAGCGTTAAGG - Intergenic
1151185313 17:72359919-72359941 ATATGCCAAGTACTGAGTCAGGG + Intergenic
1151571450 17:74927897-74927919 AGAGGCAAAGGACAGAGCCAGGG + Intronic
1154237096 18:12616378-12616400 AAAAGCAAAGGACAGAGAGAAGG + Intronic
1157558525 18:48629729-48629751 ATGAGCAAAGGACAGAAATAGGG - Intronic
1157614374 18:48978034-48978056 ATCTGCCAGGGACAGGGTTAGGG - Intergenic
1159513400 18:69426302-69426324 AAATGCAAATGACAAAGTAAAGG - Intronic
1159971484 18:74660398-74660420 ATCAGAAAAGGACAGATTTAGGG + Intronic
1160142614 18:76338975-76338997 ATGTGCCAATGACAGAGTTGGGG + Intergenic
1163636519 19:18439390-18439412 ATATGCAAATGAGACAGTTGGGG + Intergenic
1167529996 19:50009223-50009245 AGATCCAAAGGTAAGAGTTAAGG - Exonic
1167773499 19:51538642-51538664 ATGCACAAAGGACTGAGTTAGGG - Intergenic
1167778693 19:51580927-51580949 ATATGCAGAGGACACTGTTGGGG - Intronic
926770455 2:16368617-16368639 ATATGCAGAGGATAGACTTCTGG + Intergenic
926960135 2:18348148-18348170 ATAAGAAAAGTACATAGTTAAGG - Intronic
928945780 2:36770674-36770696 ATATGCTTAGGAAAGAGTTCTGG + Intronic
929645559 2:43623741-43623763 ATGTGCACAGGACTGAGTTGAGG + Intergenic
930044654 2:47158768-47158790 AAATGCCAAGGACAATGTTAAGG + Intronic
930905457 2:56561177-56561199 GTATGTAAAAAACAGAGTTAGGG - Intergenic
933171772 2:79133039-79133061 AAATGAAAAGGAAAGAGATAAGG - Intergenic
934962574 2:98690042-98690064 CTATGCAAAGGACTCAGTAAAGG + Intronic
935100648 2:99992080-99992102 AAATTTAAAGGACAGAGATAGGG - Intronic
938869693 2:135462500-135462522 TTACAGAAAGGACAGAGTTAAGG - Intronic
939524617 2:143277353-143277375 ATATGAGAAGGACAGATTCAGGG + Intronic
941190360 2:162374132-162374154 ATATGAATAGGACAGAGGTAAGG - Intronic
942778209 2:179610320-179610342 AAATGCAAAGAACAGAGATTGGG - Intronic
944500593 2:200355254-200355276 CTGTGCAAAAGACACAGTTAGGG + Intronic
945025637 2:205617103-205617125 ATTGGCAAAGGACAGTGTTATGG + Intronic
945925023 2:215794612-215794634 ATATCCAATGAACAGAGTGAGGG - Intergenic
946037691 2:216756818-216756840 AAATGAAAAGGACAGAATTATGG - Intergenic
946827921 2:223697943-223697965 AAATGAAAAGGACAGCCTTATGG - Intergenic
947373454 2:229471723-229471745 ATTTGCAAAGCACAGTGCTAAGG + Intronic
948405279 2:237712794-237712816 ATATGCAAAGAAGAGCGTGAGGG - Intronic
1169037375 20:2464303-2464325 ATCTGCAAATGACATGGTTATGG + Intronic
1169519006 20:6351180-6351202 ATATGCAAAGCAGTGAGTTAAGG + Intergenic
1170452244 20:16495650-16495672 ACAAGCAAAGCACAGAGTTAGGG - Intronic
1170505486 20:17021370-17021392 ATAGGCAGAGGACAGTGTCAGGG + Intergenic
1173604272 20:44319287-44319309 AGAAGCAAAGAACAGAATTACGG + Intergenic
1173700580 20:45067504-45067526 ATATCCAAAGTACAGGGTTTAGG - Intronic
1175784451 20:61703779-61703801 AAATGAAAAGGACACAGTCAGGG - Intronic
1177906282 21:26974675-26974697 ATATGCAAAGGACTGAGCTAGGG - Intergenic
1178222241 21:30672970-30672992 ATATGTATAAGACAGAGTTTTGG - Intergenic
1179808431 21:43854714-43854736 ATTTGTAAAGGACAGACTCAGGG + Intergenic
1182327966 22:29528551-29528573 ATTTACAAAAGACAGAGTCAGGG - Intronic
1182662042 22:31932028-31932050 ATCTGCAAAGGACAGAGGGGAGG + Intergenic
1182960398 22:34466837-34466859 TTATGCAGAGGGCAGAATTAAGG - Intergenic
1184919395 22:47595038-47595060 AAATGAAAAGGACAGATTTTGGG - Intergenic
949652282 3:6173760-6173782 TTTTTAAAAGGACAGAGTTATGG - Intergenic
950517283 3:13475656-13475678 ATATGCCAAGGACAGAGTCAGGG - Intergenic
950893556 3:16427236-16427258 ATAACCATAGGACAGAGCTAAGG + Intronic
955954482 3:64274592-64274614 ATATGCCAATGACTGAGTTTTGG - Intronic
956277138 3:67514725-67514747 AAATGGAAAGGACAAAATTATGG + Intronic
956759488 3:72426884-72426906 ATCTTCAAAGGCCAGAGGTAAGG + Intronic
956891626 3:73619882-73619904 ATTTGTAGAGGAAAGAGTTATGG + Intronic
957141607 3:76366056-76366078 ATATGCAAAGGGCTGAGAAATGG - Intronic
957891318 3:86362905-86362927 ATATGCAAAGCACTGAGGTGAGG - Intergenic
965681492 3:171256513-171256535 AGATACAAAGGACAGAGTGCTGG + Intronic
966081050 3:176001450-176001472 ATATACAAAGTACACAGTTTAGG + Intergenic
966144893 3:176799817-176799839 CTATGCAAAGGACACAGTGCAGG + Intergenic
966318229 3:178672784-178672806 AAATGAAAAGGCCAGAGTTTTGG - Intronic
966323126 3:178722966-178722988 ATATCGAAAGGACACTGTTATGG - Intronic
966551600 3:181211089-181211111 ATATGCACAGCACAGAGATAGGG + Intergenic
966928737 3:184662204-184662226 ATATGCAAAGGACCCAGTGCAGG - Intronic
967160452 3:186732877-186732899 ATATGTAAAGGACTGAGGTGAGG + Intronic
967440602 3:189503391-189503413 ATATGCAATGGAAAGAGCCATGG - Intergenic
967931636 3:194694440-194694462 AAATGCAAAGGAAGGAGTAAAGG + Intergenic
970350104 4:15193957-15193979 ATCTCGAAAGCACAGAGTTAAGG + Intergenic
971037423 4:22709327-22709349 ACAAGCAAAGGAGAGAGTAAAGG + Intergenic
971720327 4:30237041-30237063 ATATGCTCAGGACAGAATAAAGG - Intergenic
971774169 4:30939330-30939352 AGAAGCCAAGGACAGAATTATGG - Intronic
972668137 4:41187980-41188002 ATATGTATTGGAAAGAGTTAAGG - Intronic
974102371 4:57431163-57431185 ATTTAAAAAGCACAGAGTTATGG + Intergenic
976778027 4:88727814-88727836 ATCTGCAGAGGACAGAGAGATGG - Exonic
977160951 4:93634494-93634516 AAATGCAATGCACAGAGTTGTGG - Intronic
977386385 4:96345083-96345105 ATTTGAAAAGAACATAGTTATGG + Intergenic
977465149 4:97374561-97374583 ATATGTGAAGGACAGAGTAATGG + Intronic
977703101 4:100042929-100042951 AGATGCAAAGGCCAGAGTTGTGG + Intergenic
978054003 4:104240209-104240231 ATATGCAAGGCACTGTGTTAAGG - Intergenic
978393712 4:108255229-108255251 ATATGCATAGAACAAACTTATGG + Intergenic
979494995 4:121373019-121373041 AACTGAAAAGGTCAGAGTTAGGG - Intronic
980993910 4:139762595-139762617 ATATTCAAAGGACAGAATCGAGG + Intronic
981209804 4:142089834-142089856 ATTTGCAAAGCCCTGAGTTAGGG + Intronic
981964676 4:150585082-150585104 ATATACAAAGGAAATATTTATGG + Intronic
982931978 4:161419968-161419990 ACAGGCAAAGAAGAGAGTTATGG + Intronic
984032252 4:174618693-174618715 ATATTCAAAGTACAGTGTGAGGG + Intergenic
984499141 4:180536343-180536365 ATAGGCAAAGGTCAAAGATATGG - Intergenic
985445638 4:190019805-190019827 AAAAGCAAAGGACAGAGGGATGG - Intergenic
987633174 5:20503735-20503757 ATAGGCAAGAGAAAGAGTTATGG + Intronic
990725802 5:58753561-58753583 ATCTGGAAAGGTCAGCGTTAAGG + Intronic
991267622 5:64740553-64740575 ATAGGCAAAGCAGAGAGTTCTGG - Intronic
992226597 5:74624890-74624912 CTATGCCAGGGACTGAGTTAAGG - Intergenic
992230499 5:74658722-74658744 AGATGCATAGGGCAGAGTTTAGG - Intronic
993758266 5:91759417-91759439 ATATGCAAAAGAAAGAAATATGG - Intergenic
993773467 5:91961988-91962010 ATATGCTAAAGACTGAGTGATGG + Intergenic
995109896 5:108417679-108417701 ATAAGCAAAGAGCAGAGTGAGGG - Intergenic
995500692 5:112803582-112803604 ATATGCCAGGGACTGTGTTAAGG - Intronic
997224768 5:132201145-132201167 CAATGCTAAGGACAGAGTAAAGG + Intronic
997305283 5:132831441-132831463 GTATTCATAGGACAGAGTTTGGG - Intergenic
998554971 5:143114444-143114466 ATATACTAAGGATAGATTTAAGG + Intronic
999092606 5:148950434-148950456 ATCTGCAAACAACAGAGTCATGG - Intronic
1000221217 5:159216375-159216397 ATAAGCAAAGGACAACGTAAGGG - Intergenic
1000246566 5:159453267-159453289 ATAAGCAGAGGCCAGAGTTCCGG - Intergenic
1001804246 5:174569946-174569968 AAATTCACAGGAGAGAGTTAGGG + Intergenic
1002037723 5:176485552-176485574 CTATTTCAAGGACAGAGTTAAGG + Intronic
1003638455 6:7856482-7856504 AAATGCAAAGGAATGTGTTATGG + Intronic
1005702407 6:28415083-28415105 AGAACCAAAGGACAGAGTTTAGG - Intergenic
1007904669 6:45447378-45447400 ATTTGCAAAAGAGAGAGATATGG - Intronic
1008034594 6:46733200-46733222 ATGTGCAAAGGTGAGAGTGAGGG + Intronic
1008284766 6:49635644-49635666 GAAAGCTAAGGACAGAGTTAGGG - Intronic
1008312417 6:49992285-49992307 AAAAGCAGGGGACAGAGTTAAGG + Intergenic
1009329802 6:62403511-62403533 AAATGCATAGGGCAGAGTTCAGG + Intergenic
1010588851 6:77688811-77688833 ATGTGCACAGGACAGACATATGG - Intergenic
1011171716 6:84512092-84512114 AAGTGCAAAGTACAGAGTAAGGG - Intergenic
1013307437 6:108862632-108862654 ATTGGCAAAGGGCAGAGATAGGG + Intronic
1014417348 6:121198407-121198429 ATATGCTCAGGACAGGCTTAGGG + Intronic
1014736734 6:125102590-125102612 ACATGCAAAGGAAAGAAATAAGG + Intergenic
1015001545 6:128222470-128222492 ATATTCACAGGACTGGGTTAGGG - Intronic
1018444267 6:163840980-163841002 ACATGGAAAGAACAGAATTAAGG - Intergenic
1018746671 6:166767660-166767682 CTTTGCAAAGGACTGAGTTTGGG + Intronic
1020333125 7:7040424-7040446 ATATCCAATGGACAGTGCTATGG - Intergenic
1020521184 7:9189520-9189542 AAAAGGAAAGGACAGAGTTGGGG + Intergenic
1020859942 7:13479404-13479426 ATAGGGAGAGGAGAGAGTTAGGG + Intergenic
1020892507 7:13896870-13896892 AGATGCATTAGACAGAGTTAAGG + Intronic
1021501419 7:21336023-21336045 AATTGCAAAAGCCAGAGTTAAGG - Intergenic
1022621733 7:31991392-31991414 CTATACAAAGGAAAGAGCTAGGG + Intronic
1023240131 7:38135438-38135460 GTATGCAAAGGAAATATTTAAGG + Intergenic
1025800068 7:64778072-64778094 AAAATCAAAGGACAAAGTTAAGG - Intergenic
1026148415 7:67768232-67768254 ATTTGCAAATGGCAGAGCTAGGG + Intergenic
1026210043 7:68295993-68296015 ATTGGCAAAGGAAGGAGTTAAGG - Intergenic
1026275866 7:68875566-68875588 ATAAGCAAAGGAGAGAGGTCTGG - Intergenic
1029911653 7:104157965-104157987 ATTTCCAAAGGATAGAGTTAAGG - Intronic
1031732471 7:125315787-125315809 AAATGCAGAGGAGAGATTTAGGG - Intergenic
1032875237 7:136031651-136031673 ATATGCCAGGCACTGAGTTAGGG + Intergenic
1033895838 7:146068827-146068849 ATATTCAAAGGACAAATTTCTGG + Intergenic
1037076172 8:14721660-14721682 ATAGGAAAAGGACAGAAATAGGG - Intronic
1038683155 8:29688824-29688846 ATATGTGAGGGACAGGGTTATGG - Intergenic
1039028975 8:33288935-33288957 ATATGAAAATGAGAGAGTTGAGG + Intergenic
1040409044 8:47136126-47136148 TTATCCAAAGGAAAGAGTTCAGG - Intergenic
1041697387 8:60750326-60750348 ATGTGCCAAGGACTGTGTTAAGG + Intronic
1042677025 8:71332647-71332669 ATATTCATAGGACAGAATTATGG - Intronic
1043821347 8:84869222-84869244 ATATGCACAGGTAAGAGTTTAGG - Intronic
1043995536 8:86810734-86810756 ATGTGGAAAGGAAAGAGCTAAGG - Intergenic
1047511983 8:125522351-125522373 CAAAACAAAGGACAGAGTTATGG - Intergenic
1049491489 8:142905576-142905598 ATATGCAGAGGTCCGAGTTTTGG - Intronic
1050157615 9:2684271-2684293 ATCTGGAGAGGACAGAGTGATGG - Intergenic
1050474440 9:6025453-6025475 ATTTTCAAAAGACACAGTTATGG - Intergenic
1050567137 9:6897246-6897268 ATAGGCAGAGGAGAGAGTGAAGG + Intronic
1051187579 9:14476193-14476215 ATTTGCAAATGACAAAGATAAGG + Intergenic
1053330466 9:37201742-37201764 ATGTGAAAAGGGCAGAGTAATGG + Intronic
1053613861 9:39743829-39743851 CGATGCAAAGAACAGAGTTGAGG + Intergenic
1053900859 9:42794245-42794267 CGATGCAAAGAACAGAGTTGAGG - Intergenic
1054239655 9:62598568-62598590 CGATGCAAAGAACAGAGTTGAGG - Intergenic
1054260789 9:62863298-62863320 CGATGCAAAGAACAGAGTTGAGG + Intergenic
1054553788 9:66633095-66633117 CGATGCAAAGAACAGAGTTGAGG - Intergenic
1054950531 9:70846018-70846040 TTGTGTAAAGGACAGAGGTAGGG + Intronic
1055583994 9:77737034-77737056 AAAAGGAAAGGAAAGAGTTAAGG - Intronic
1056902833 9:90616317-90616339 CTGTGCAGAGGACAGACTTAAGG + Intronic
1056929755 9:90864307-90864329 ATAAACAAAGGACACAGATACGG + Intronic
1059618142 9:115973362-115973384 ATATGCAAAATACAGTGTTTTGG + Intergenic
1059859376 9:118441491-118441513 AGATGCAAAGAGCAGTGTTAGGG - Intergenic
1061704332 9:132441165-132441187 GTATGCAAATGACAGATTTGTGG - Intronic
1186316629 X:8377831-8377853 ATATGTAAAACACAGAGTTATGG + Intergenic
1186935037 X:14440333-14440355 ATTTGCAAAGGACAAAAATATGG - Intergenic
1187994582 X:24912396-24912418 ATCTGCAAAAGACACTGTTAAGG + Intronic
1188542013 X:31261484-31261506 ATATGTAGAGGAAAGAGTAATGG - Intronic
1188922645 X:35996521-35996543 ATAAGCACAGGAAAGAGTCAAGG - Intergenic
1189020569 X:37333618-37333640 AGATTCAGAGGACAGAGTTCCGG - Intergenic
1192183083 X:68928565-68928587 AGATGCAAAGGCCAGAGGTAAGG - Intergenic
1192772310 X:74205716-74205738 GTATTCAAAGGACAGACATATGG - Intergenic
1192815917 X:74591986-74592008 ATATGGAAAGGGCAGAGTCACGG - Exonic
1194546383 X:95239880-95239902 AAAAGCAAAGGACAAAGTAAAGG + Intergenic
1194899414 X:99490477-99490499 CAATGCAAAGGAAAGACTTAAGG - Intergenic
1194939829 X:99996200-99996222 ACATGCAAAGTACAGAAATAAGG - Intergenic
1197190929 X:123647502-123647524 ATATGAACAGGACAGAGTACAGG + Intronic
1197307440 X:124861003-124861025 ATATACAAATGACAGAGCTTAGG + Intronic