ID: 1140016638

View in Genome Browser
Species Human (GRCh38)
Location 16:71193154-71193176
Sequence CTATAGGGATCATGTGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140016633_1140016638 10 Left 1140016633 16:71193121-71193143 CCTGTTTCTAACTCCAGAATGTA 0: 1
1: 0
2: 0
3: 20
4: 247
Right 1140016638 16:71193154-71193176 CTATAGGGATCATGTGTAATTGG 0: 1
1: 0
2: 1
3: 3
4: 67
1140016634_1140016638 -3 Left 1140016634 16:71193134-71193156 CCAGAATGTAAGCTTCTTGCCTA 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1140016638 16:71193154-71193176 CTATAGGGATCATGTGTAATTGG 0: 1
1: 0
2: 1
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140016638 Original CRISPR CTATAGGGATCATGTGTAAT TGG Intronic
900434028 1:2618743-2618765 CTATGGGGATCCTGTGTTATTGG - Intronic
905895418 1:41542793-41542815 TCATACGGATCATGTGTCATAGG - Intronic
908517254 1:64905792-64905814 TTGTAGGGATCATGTGAGATAGG - Intronic
910491444 1:87776941-87776963 CTACAGGGATTCTGTGAAATTGG + Intergenic
912375514 1:109206465-109206487 CTATAGACATCATCTGTATTTGG + Intronic
918381216 1:183957351-183957373 CTCTGGGGATGATGTGGAATGGG - Intronic
918516541 1:185369763-185369785 CTATATGGATCAAATGAAATTGG - Intergenic
921086447 1:211798287-211798309 CCATAGAGATCCTGAGTAATGGG + Intronic
921588036 1:216971262-216971284 CTATAAGAATCATTAGTAATTGG + Intronic
924388822 1:243528266-243528288 CTAAAGGGAGCATGTAGAATGGG - Intronic
1065117566 10:22497472-22497494 CTATAGGGAGGAGGTGTGATTGG + Intergenic
1070788850 10:79177976-79177998 CATTAAGGATCATGTCTAATAGG - Intronic
1071459145 10:85875803-85875825 CAATAGAAATAATGTGTAATGGG - Intronic
1073904405 10:108261141-108261163 CTATAAGGCTCATCTGTAACAGG - Intergenic
1080344560 11:31310048-31310070 CTATCAGGATCATGTGGAGTTGG - Intronic
1087833934 11:102850934-102850956 CTGTAGGCATCCTGTGTGATTGG + Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1100024654 12:90113105-90113127 CTGCTGGGATCATGTGTAACTGG + Intergenic
1101541713 12:105671466-105671488 CCACAGGCATCATGTGTGATCGG - Intergenic
1102376575 12:112426647-112426669 ACACAGGGGTCATGTGTAATAGG + Intronic
1104990740 12:132622544-132622566 CTGTGGGGACCATGTGTCATGGG - Intergenic
1107750580 13:43561423-43561445 CTATATGCATCATATGTATTAGG - Intronic
1111493202 13:89012204-89012226 CTGTTGGCATCCTGTGTAATGGG + Intergenic
1119515243 14:75242783-75242805 TTAAAGGGATTATGTGTATTAGG + Intronic
1125595819 15:40885436-40885458 CTTTAGGGAGCATGGGAAATGGG - Intergenic
1129117874 15:73375291-73375313 GAAAAGGGATCATGTGAAATTGG - Intergenic
1140016638 16:71193154-71193176 CTATAGGGATCATGTGTAATTGG + Intronic
1143687305 17:8528278-8528300 CTAAAGGGGTGATGGGTAATAGG - Intronic
1144411487 17:15006276-15006298 TTATAGGGATGCTCTGTAATAGG + Intergenic
1158368936 18:56775051-56775073 CTATAAGGAACAAGTGTAAAAGG - Intronic
1168241420 19:55091032-55091054 ATATAGGGTCCATGTGCAATAGG - Exonic
930352504 2:50275096-50275118 CTTTAGAGGTCCTGTGTAATTGG + Intronic
931991971 2:67799556-67799578 CTATAGTGGTCATGTGTATGTGG + Intergenic
932978318 2:76631484-76631506 CAATAGGGCTCCTGTATAATAGG - Intergenic
940126834 2:150335487-150335509 CTAAAGGGAACATGTGTTGTTGG - Intergenic
942192925 2:173488713-173488735 CTATAGGAATAGTGTGTAAAAGG - Intergenic
946503514 2:220275134-220275156 ACATAGGGAAAATGTGTAATTGG - Intergenic
948249259 2:236512401-236512423 CTATGGGCATCATGAGTCATCGG - Intergenic
1173549159 20:43920556-43920578 CTATAGGGAGCATGTTTAGATGG - Intronic
1179001685 21:37467039-37467061 CACTAAGGATCATGTTTAATAGG - Intronic
1180572789 22:16744248-16744270 GCATTGGGATCATGTGGAATAGG - Intergenic
1181752871 22:25001816-25001838 CTACAGGAATCCTGTGTTATGGG - Intronic
951108954 3:18778338-18778360 CTAAAGGGAGCAGGTGTGATTGG - Intergenic
957104905 3:75874667-75874689 GCATTGGGATCATGTGGAATAGG + Intergenic
962653238 3:137517114-137517136 CTGTAGGGATCAGGTATAACTGG + Intergenic
973068588 4:45828586-45828608 ATTTAGAGATCATGTGTAAATGG - Intergenic
978359432 4:107913207-107913229 CTATAGGAATTATATGTTATAGG - Exonic
985821297 5:2161765-2161787 ATATAGGGATGATTTGTGATGGG - Intergenic
986130764 5:4927872-4927894 CAATAGAGATCATGAGTATTAGG - Intergenic
987348883 5:17003845-17003867 CTGTATGCATCATGTCTAATAGG - Intergenic
988013741 5:25526641-25526663 CTATAGGAATCATGTTGCATAGG - Intergenic
989417446 5:41196207-41196229 CTATAGAGATCATGTTCAGTAGG + Intronic
990365816 5:55069342-55069364 CTATAGAGGTCAGTTGTAATGGG - Intergenic
994427628 5:99613038-99613060 CTTTAGTGATTGTGTGTAATTGG + Intergenic
995158564 5:108945958-108945980 CTATAGAGTTTATGTGTATTTGG + Intronic
997221599 5:132171108-132171130 CTATAGGTGTCAGGTGAAATTGG - Intergenic
999487335 5:152010547-152010569 CTAAAGGGTTTATGTATAATTGG + Intergenic
1004900375 6:20188057-20188079 CTATATGGATCATGTGTAAGAGG + Intronic
1007500609 6:42294014-42294036 CCTTAGGGATCAGGTGTCATTGG - Intronic
1009301282 6:62026269-62026291 CTACAGAGATCAGGTGTAATAGG - Intronic
1009992285 6:70858343-70858365 CAATAGGGATAATATGTTATAGG + Exonic
1015853519 6:137599335-137599357 GTATAGGCACCATGTGGAATTGG - Intergenic
1016184874 6:141185517-141185539 ATTTAGGGAGCATGTGTAATGGG - Intergenic
1022788159 7:33659882-33659904 CCAGAGGGGTCATGTGTGATGGG - Intergenic
1023223041 7:37940280-37940302 CTATAAGGAGCATGAGGAATAGG + Intronic
1024432094 7:49300898-49300920 CTATAGGGATCATAGCTGATGGG - Intergenic
1042973999 8:74444099-74444121 CTTTAGGGACCATTTGCAATAGG - Intronic
1043485139 8:80691764-80691786 CAATAGGAAACATGTTTAATAGG - Intronic
1044524451 8:93236498-93236520 TTGCAGGGAACATGTGTAATTGG + Intergenic
1186051194 X:5597452-5597474 CTATGGGGAGCATGTGAAAACGG + Intergenic
1194392510 X:93337733-93337755 TTATAATGACCATGTGTAATAGG - Intergenic
1199801085 X:151252140-151252162 CTATTGGCATCCTGTGTCATAGG - Intergenic