ID: 1140018601

View in Genome Browser
Species Human (GRCh38)
Location 16:71214611-71214633
Sequence GTGCTCACACATATGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140018598_1140018601 5 Left 1140018598 16:71214583-71214605 CCTTGGTTTATCTGACAGGAACC 0: 1
1: 0
2: 1
3: 10
4: 121
Right 1140018601 16:71214611-71214633 GTGCTCACACATATGCAGCCTGG 0: 1
1: 0
2: 2
3: 5
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140018601 Original CRISPR GTGCTCACACATATGCAGCC TGG Intronic
900487464 1:2930227-2930249 GTGCGCACACATGTGCACGCAGG + Intergenic
900993028 1:6106667-6106689 GCGCTCCGACATCTGCAGCCGGG + Exonic
902540659 1:17152163-17152185 TTGCTCACACATATGCACATAGG - Intergenic
903455036 1:23481728-23481750 GTGCTTACACTTACACAGCCAGG + Intronic
906132261 1:43467722-43467744 GTTCTTACACCTATGCAGCCTGG + Intergenic
907488129 1:54791161-54791183 TTGCTCACATAGAAGCAGCCAGG - Intronic
911795953 1:102076537-102076559 GTTCTCACACATATACAGTTGGG + Intergenic
916297921 1:163240563-163240585 GTGATCACAACTCTGCAGCCTGG - Intronic
916767576 1:167876389-167876411 GTGAGCAAACATATGCACCCTGG - Intronic
916774250 1:167943701-167943723 GTGTTCACACAGATGCAGAGTGG - Intronic
917177375 1:172251568-172251590 ATACACACACATATGCAGCCTGG - Intronic
917721528 1:177791022-177791044 CTCCTCTCACATATGCAGCATGG + Intergenic
919349293 1:196428859-196428881 CTGCCCACACATGGGCAGCCAGG + Intronic
924176158 1:241393261-241393283 GTGCCCATAGATATGCAACCTGG - Intergenic
924201431 1:241663361-241663383 GTGCTCACATATGGGCACCCCGG + Intronic
1065889435 10:30108604-30108626 GTTGTCACACATGAGCAGCCTGG + Intronic
1066205762 10:33187894-33187916 GGGCTCTCACATAAGCAACCAGG - Intronic
1068439157 10:57029887-57029909 TTACTCACAGATAGGCAGCCAGG - Intergenic
1068730799 10:60356062-60356084 GGGCTCTCACATAAGCAGCCCGG - Intronic
1069422008 10:68255002-68255024 TTGCTCACATATGTGGAGCCTGG - Intergenic
1070637403 10:78140287-78140309 CTGCTCACACATGTTCATCCTGG - Intergenic
1073571176 10:104582337-104582359 GTGCTCTACCATATGCTGCCTGG - Intergenic
1075091790 10:119447939-119447961 GTGCTCACACACTCACAGCCTGG - Intronic
1077916702 11:6616266-6616288 ATGCTTACACCTCTGCAGCCTGG - Intronic
1078073577 11:8136329-8136351 GTGCTCACAAAGATGCAGGAGGG + Intronic
1078144773 11:8715205-8715227 ATTTTCACACATAGGCAGCCAGG - Intronic
1079458387 11:20657224-20657246 GGGCTCCCACAGATGCTGCCAGG + Exonic
1083186434 11:61020417-61020439 GTGCACACACACATGCAGCCTGG - Intergenic
1084672505 11:70615626-70615648 TTGCTTACAGATATGCAGCAAGG - Intronic
1086652260 11:89307071-89307093 GAGCTCACACTGATGCAGGCAGG + Intergenic
1087679454 11:101203159-101203181 TTGCTCACAGATATGCAATCTGG - Intergenic
1091209611 11:133844934-133844956 GTGCTAACACATTTCCTGCCAGG + Intronic
1091389771 12:118909-118931 GTGCTCACACAGCTCCTGCCAGG - Intronic
1091529412 12:1339926-1339948 GTGCACACACACATGCACACTGG + Intronic
1093498611 12:19784309-19784331 GGACTCACACTTCTGCAGCCTGG - Intergenic
1093703992 12:22254659-22254681 TTGCTGAGACATATTCAGCCAGG - Intronic
1098782666 12:74706596-74706618 TTGCTCACAATTCTGCAGCCTGG + Intergenic
1099632889 12:85173439-85173461 TTTCTCACAAATCTGCAGCCTGG + Intronic
1102809669 12:115813380-115813402 TTGCTCACAAATCTGCAGCTTGG - Intergenic
1103679033 12:122678733-122678755 GTGATCACACCAATTCAGCCTGG - Intergenic
1104047883 12:125175978-125176000 TTGCTCACACATCTGCAGTTTGG - Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106116844 13:26825095-26825117 GAGTTCACACATCTGCAGGCTGG + Intergenic
1113285921 13:108848964-108848986 GAGCACACAGATCTGCAGCCAGG + Intronic
1116424882 14:44778845-44778867 AAGCTCACACATATGGTGCCGGG - Intergenic
1121022444 14:90588651-90588673 GTGCTCACTTCTATCCAGCCTGG + Intronic
1125506996 15:40272780-40272802 CTGCTCACAGATGTCCAGCCTGG - Intronic
1127299020 15:57634430-57634452 CTGCAAACTCATATGCAGCCAGG - Intronic
1128841974 15:70857784-70857806 AAGCTCACACATAAGCAGCAGGG + Intronic
1129845068 15:78764432-78764454 GGGCACACAGATGTGCAGCCTGG + Intronic
1130233548 15:82114348-82114370 GTGCTCACACTTACCAAGCCTGG - Intergenic
1130938326 15:88488444-88488466 GTCCTCTCCCAGATGCAGCCCGG - Intergenic
1131347495 15:91664334-91664356 GTTCACACAGATATCCAGCCTGG + Intergenic
1132132581 15:99296592-99296614 CTGACCACACATATACAGCCTGG - Intronic
1132336815 15:101053116-101053138 TTTCTCAGACATATGCTGCCCGG + Intronic
1132592884 16:734004-734026 CTGCTCACCCAGAGGCAGCCAGG - Intronic
1136124979 16:28172538-28172560 GTGCTGACGTATATGCAGGCAGG + Intronic
1140018601 16:71214611-71214633 GTGCTCACACATATGCAGCCTGG + Intronic
1142472279 17:170960-170982 GTGCTCTCCCCTCTGCAGCCTGG - Intronic
1142472291 17:170994-171016 GTGCTCTCCCCTCTGCAGCCTGG - Intronic
1142472350 17:171156-171178 GTGCTCTCCCCTCTGCAGCCTGG - Intronic
1142472362 17:171190-171212 GTGCTCTCCCCTCTGCAGCCTGG - Intronic
1142472374 17:171224-171246 GTGCTCTCCCCTCTGCAGCCTGG - Intronic
1142472433 17:171386-171408 GTGCTCTCCCCTCTGCAGCCTGG - Intronic
1142472468 17:171484-171506 GTGCTCTCCCCTCTGCAGCCTGG - Intronic
1142472504 17:171582-171604 GTGCTCTCCCCTCTGCAGCCTGG - Intronic
1142472562 17:171744-171766 GTGCTCTCCCCTCTGCAGCCTGG - Intronic
1142472597 17:171842-171864 GTGCTCTCCCCTCTGCAGCCTGG - Intronic
1143055164 17:4156930-4156952 GTTCTCACACACACGCAGCGGGG - Exonic
1146098107 17:29952030-29952052 GTGCTCACAGTTATGGAGGCTGG + Intronic
1160659880 19:292918-292940 GTGGTCACTCATTTGCAGACAGG - Intergenic
1161218516 19:3106822-3106844 TGGCTCACACCTATGCACCCAGG - Intronic
1163155880 19:15439713-15439735 GGGCTCACGCATGTGCAGCTTGG + Intronic
1163183782 19:15622253-15622275 GTGCTCAAACACATCCAGACAGG - Exonic
1163187478 19:15649194-15649216 GTGCTCAAACATGTCCAGACGGG - Exonic
1163217309 19:15890377-15890399 GTGCTCAAACATATCCAAACAGG + Exonic
1165186375 19:34025803-34025825 GCACTCACACATGTGCAACCTGG - Intergenic
1165361651 19:35340722-35340744 GTTCTCACACAGATGCAGGAAGG + Intronic
1166862850 19:45819696-45819718 CTGCTCACCCATATCCATCCTGG - Intronic
925483376 2:4301515-4301537 GTTCTCACACATCTGGAGGCTGG - Intergenic
928449511 2:31365968-31365990 GAACTCACTTATATGCAGCCAGG + Exonic
940456946 2:153913340-153913362 GTGCACACACATATGGTGGCAGG + Intronic
943719524 2:191189180-191189202 GTGCAAACACATAAGCACCCGGG - Intergenic
944080798 2:195786444-195786466 GTACTCATACACATGCAGCATGG - Intronic
946570796 2:221021974-221021996 GTGCTCACAACTCTGCAGGCTGG - Intergenic
948565364 2:238882950-238882972 GGGCTCAGACATCTGCACCCTGG - Intronic
948912300 2:241010741-241010763 GGGCTCACACACAGGCCGCCTGG - Intronic
1169067159 20:2700577-2700599 GTCCCCACACATCTGCACCCAGG + Intronic
1169313716 20:4570647-4570669 TTGCTCACACATCTGCAGGTTGG + Intergenic
1171777829 20:29387373-29387395 GTGCTGAGACATATGGAGCTGGG + Intergenic
1175624911 20:60482053-60482075 TAGCTCACACTTCTGCAGCCTGG + Intergenic
1175939097 20:62529697-62529719 GTGCTCAAACAGCGGCAGCCTGG + Intergenic
1176172626 20:63702916-63702938 GAGCTCAGACCTCTGCAGCCTGG + Intronic
1176794912 21:13364400-13364422 GGTTACACACATATGCAGCCTGG + Intergenic
1177526714 21:22302235-22302257 GTGCACACACATATGTATACAGG + Intergenic
1178159665 21:29897083-29897105 GTGCACACACACATGCACACAGG - Intronic
1178395280 21:32237324-32237346 GTGCTAACACATCAGCAACCTGG - Intergenic
1179618126 21:42594883-42594905 GTGATCACACACATGCCACCGGG + Intergenic
1180856770 22:19052119-19052141 GTGAAAACACATTTGCAGCCAGG + Intronic
1180957487 22:19747432-19747454 CTCCTCACACCTCTGCAGCCTGG - Intergenic
1181047789 22:20223810-20223832 GTCCTCACACATGGGCAGCAGGG - Intergenic
1181985487 22:26797342-26797364 GGGCACACACATATGCATCTGGG + Intergenic
1183188564 22:36306634-36306656 GTGCCCACACAGTTGCAGCTGGG + Intronic
1183585799 22:38752329-38752351 GTGCTCATACACATGGAGCAAGG + Intronic
1183616449 22:38948699-38948721 GGGGCCACACATATGCAGTCAGG + Intergenic
1184707724 22:46225927-46225949 ATGCTCACACACATGCACCCAGG + Intronic
949668181 3:6365859-6365881 TTGCTCACACAAATGCAGTTTGG - Intergenic
951357495 3:21685997-21686019 GTGGTCACAGATGTCCAGCCTGG + Intronic
951543813 3:23806580-23806602 CTGCTCACAGCTATGCGGCCGGG - Intronic
955131542 3:56174422-56174444 GTGCTCACACATACCCATGCTGG + Intronic
956160679 3:66348370-66348392 GTGCACACACATATGTATCTAGG + Intronic
957581520 3:82079197-82079219 GAGGTCACACATATGCCGCTGGG - Intergenic
960742564 3:120851125-120851147 GTGCTGACAAATGAGCAGCCTGG + Intergenic
961464083 3:127070971-127070993 TTGCTCACACATCTGGTGCCAGG + Intergenic
963328709 3:143890637-143890659 ATGCACAGACATATGCAGACAGG + Intergenic
964904282 3:161699468-161699490 GTGCTGAAATATATGCAGCAAGG - Intergenic
965186065 3:165465973-165465995 GTTCTCACAAATCTGCAGCAGGG - Intergenic
968685998 4:1959182-1959204 GAGCTGACACGTATCCAGCCAGG - Intronic
971602977 4:28619514-28619536 TTGCTCACAGTTTTGCAGCCTGG + Intergenic
973020915 4:45205693-45205715 GTGCTCACTCACATTCAGGCAGG - Intergenic
975201163 4:71591444-71591466 GTGCGCACACATGTGCATTCAGG + Intergenic
978588847 4:110302418-110302440 GTACTGACACATATGCAACATGG - Intergenic
980685326 4:136220047-136220069 GTGCTCACACACATGCTAGCAGG + Intergenic
982826508 4:160009978-160010000 GGGCTCACACTTTTGCAGCTGGG - Intergenic
983238024 4:165201894-165201916 GTTCTCATACATATGCAGCCTGG + Intronic
984853152 4:184171083-184171105 CAGCTCACAAATATGCAGTCTGG + Intronic
985900390 5:2784325-2784347 GTGCACACACATATGCACATAGG + Intergenic
985900415 5:2784664-2784686 GTGCACACACATATGCACACAGG + Intergenic
987072200 5:14348529-14348551 GTGCACACACATATACAAGCAGG - Intronic
987072212 5:14348972-14348994 GTGCGCACACATATACACACAGG - Intronic
987072221 5:14349306-14349328 GTGCACACACATATACACACAGG - Intronic
990140618 5:52698998-52699020 GTTCCCACACATATGAAACCAGG - Intergenic
993123686 5:83805972-83805994 GTATTCACATAAATGCAGCCAGG - Intergenic
993658259 5:90598799-90598821 GTGCTGACACATTTGCACCATGG + Intronic
997475694 5:134141141-134141163 GTGCACACACATCTGCACACGGG - Intronic
999376556 5:151090684-151090706 CTGCTCACATATAGGCAGCTAGG + Intronic
1002185189 5:177451216-177451238 GTGCCCACAGCAATGCAGCCAGG + Intronic
1004170459 6:13291855-13291877 GAGCTCTCACCTGTGCAGCCAGG + Intronic
1005860797 6:29898408-29898430 TTGCTCACACATATGCACATAGG - Intergenic
1006653718 6:35572233-35572255 GAGATCACACATTTACAGCCAGG + Intergenic
1010935956 6:81861623-81861645 GTGCTCACACAGAAGCAGGAAGG + Intergenic
1012592468 6:100999181-100999203 GTGCTCACACATATCTCTCCTGG - Intergenic
1016098014 6:140061882-140061904 GTACTCACATAAAGGCAGCCTGG + Intergenic
1018468905 6:164079536-164079558 GTCCTCACACACATGCAGGAGGG - Intergenic
1019560686 7:1655106-1655128 ACGCACACACATATGTAGCCTGG - Intergenic
1029894217 7:103964834-103964856 GTGCCCACACAAATACAGTCAGG + Intronic
1029966121 7:104742779-104742801 GTGCTCACTGATATGAAGGCAGG - Intronic
1030859042 7:114600516-114600538 GTGCTCTCACATATTTATCCAGG - Intronic
1032333238 7:130999758-130999780 TTGCTCACACAGAGGCAGCATGG - Intergenic
1035542333 8:451086-451108 ATTCTCACACATATTCAGCATGG - Intronic
1035623119 8:1049890-1049912 GTGTACACACATGTGCAGGCAGG + Intergenic
1036145687 8:6252725-6252747 GTACTCATACATCTGCCGCCGGG - Intergenic
1037769540 8:21790214-21790236 GGGCTCACACCCACGCAGCCCGG + Intronic
1040104035 8:43529960-43529982 ATGCTCACTCATATGAAGACAGG - Intergenic
1040414679 8:47185709-47185731 GACCTCACACAAATGGAGCCAGG + Intergenic
1040985861 8:53293900-53293922 GGGCTTACACATCTGCAGGCTGG + Intergenic
1043342095 8:79252238-79252260 GGACTCAAACATATGCAGTCTGG - Intergenic
1046531354 8:115450214-115450236 TTGCACCCACCTATGCAGCCTGG + Intronic
1048882910 8:138884993-138885015 GTGCACACACATATGCACATGGG - Intronic
1049424025 8:142529615-142529637 ATGCTCACACGTATGCACACTGG - Intronic
1049564622 8:143331742-143331764 GGGCTCTCTCATAAGCAGCCAGG - Intronic
1057899293 9:98935601-98935623 GTGCCCACACATAAGCAACTTGG - Intergenic
1060903818 9:127286898-127286920 TTTCTCTCTCATATGCAGCCAGG + Intronic
1191105359 X:56768937-56768959 GTGCGCACAGGCATGCAGCCTGG - Intergenic
1191106352 X:56774339-56774361 GTGCGCACAGGCATGCAGCCTGG - Intergenic
1191107345 X:56779741-56779763 GTGCGCACAGGCATGCAGCCTGG - Intergenic
1191111204 X:56804155-56804177 GTGCTCACAAGCAGGCAGCCTGG - Intergenic
1192690124 X:73353902-73353924 GTGCTCACTCCTATGCAGTGGGG + Intergenic
1201673783 Y:16556406-16556428 TTGCTCACAGATATGGAGGCTGG - Intergenic