ID: 1140022048

View in Genome Browser
Species Human (GRCh38)
Location 16:71247957-71247979
Sequence CTGTGTGCGTGGCAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140022035_1140022048 22 Left 1140022035 16:71247912-71247934 CCTCCCAAAGTGTTGGGATTACA 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
Right 1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG No data
1140022033_1140022048 28 Left 1140022033 16:71247906-71247928 CCTTAGCCTCCCAAAGTGTTGGG 0: 330
1: 17240
2: 194108
3: 295525
4: 192029
Right 1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG No data
1140022037_1140022048 18 Left 1140022037 16:71247916-71247938 CCAAAGTGTTGGGATTACAGACA 0: 326
1: 12327
2: 122135
3: 254385
4: 241462
Right 1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG No data
1140022036_1140022048 19 Left 1140022036 16:71247915-71247937 CCCAAAGTGTTGGGATTACAGAC 0: 674
1: 27140
2: 259260
3: 276236
4: 167084
Right 1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140022048 Original CRISPR CTGTGTGCGTGGCAGGGGGA GGG Intergenic
No off target data available for this crispr