ID: 1140028157

View in Genome Browser
Species Human (GRCh38)
Location 16:71310989-71311011
Sequence CCTTGGTTTCCTCTCATATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140028157_1140028163 24 Left 1140028157 16:71310989-71311011 CCTCATATGAGAGGAAACCAAGG No data
Right 1140028163 16:71311036-71311058 CATAGTCTCACACTCCTGTACGG No data
1140028157_1140028159 -10 Left 1140028157 16:71310989-71311011 CCTCATATGAGAGGAAACCAAGG No data
Right 1140028159 16:71311002-71311024 GAAACCAAGGTTTAAAGAGATGG No data
1140028157_1140028164 27 Left 1140028157 16:71310989-71311011 CCTCATATGAGAGGAAACCAAGG No data
Right 1140028164 16:71311039-71311061 AGTCTCACACTCCTGTACGGAGG No data
1140028157_1140028160 -7 Left 1140028157 16:71310989-71311011 CCTCATATGAGAGGAAACCAAGG No data
Right 1140028160 16:71311005-71311027 ACCAAGGTTTAAAGAGATGGAGG No data
1140028157_1140028162 -3 Left 1140028157 16:71310989-71311011 CCTCATATGAGAGGAAACCAAGG No data
Right 1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140028157 Original CRISPR CCTTGGTTTCCTCTCATATG AGG (reversed) Intergenic
No off target data available for this crispr