ID: 1140028162

View in Genome Browser
Species Human (GRCh38)
Location 16:71311009-71311031
Sequence AGGTTTAAAGAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140028155_1140028162 -1 Left 1140028155 16:71310987-71311009 CCCCTCATATGAGAGGAAACCAA No data
Right 1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG No data
1140028157_1140028162 -3 Left 1140028157 16:71310989-71311011 CCTCATATGAGAGGAAACCAAGG No data
Right 1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG No data
1140028156_1140028162 -2 Left 1140028156 16:71310988-71311010 CCCTCATATGAGAGGAAACCAAG No data
Right 1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140028162 Original CRISPR AGGTTTAAAGAGATGGAGGA AGG Intergenic
No off target data available for this crispr