ID: 1140029058

View in Genome Browser
Species Human (GRCh38)
Location 16:71319687-71319709
Sequence CTTTGGAAGGCCAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140029058_1140029064 -8 Left 1140029058 16:71319687-71319709 CCGTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1140029064 16:71319702-71319724 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
1140029058_1140029066 11 Left 1140029058 16:71319687-71319709 CCGTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1140029066 16:71319721-71319743 CAGGCATGAGCCATTGCACCTGG 0: 315
1: 7781
2: 29726
3: 76156
4: 132986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140029058 Original CRISPR CTTTGGAAGGCCAAGGTGGA CGG (reversed) Intergenic
Too many off-targets to display for this crispr