ID: 1140031888

View in Genome Browser
Species Human (GRCh38)
Location 16:71345550-71345572
Sequence TCTGAAGGTCAGTCACAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140031888_1140031891 -1 Left 1140031888 16:71345550-71345572 CCGGGCTGTGACTGACCTTCAGA No data
Right 1140031891 16:71345572-71345594 ATGCAGGCAGCAGAGAGAAGAGG No data
1140031888_1140031893 18 Left 1140031888 16:71345550-71345572 CCGGGCTGTGACTGACCTTCAGA No data
Right 1140031893 16:71345591-71345613 GAGGACAAAAGTGCACCGCTGGG No data
1140031888_1140031892 17 Left 1140031888 16:71345550-71345572 CCGGGCTGTGACTGACCTTCAGA No data
Right 1140031892 16:71345590-71345612 AGAGGACAAAAGTGCACCGCTGG No data
1140031888_1140031895 24 Left 1140031888 16:71345550-71345572 CCGGGCTGTGACTGACCTTCAGA No data
Right 1140031895 16:71345597-71345619 AAAAGTGCACCGCTGGGGAAAGG No data
1140031888_1140031894 19 Left 1140031888 16:71345550-71345572 CCGGGCTGTGACTGACCTTCAGA No data
Right 1140031894 16:71345592-71345614 AGGACAAAAGTGCACCGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140031888 Original CRISPR TCTGAAGGTCAGTCACAGCC CGG (reversed) Intergenic
No off target data available for this crispr