ID: 1140035020

View in Genome Browser
Species Human (GRCh38)
Location 16:71365126-71365148
Sequence CCTCCATCTGGAGCACCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140035020 Original CRISPR CCTCCATCTGGAGCACCCTC TGG (reversed) Intronic
900109031 1:997944-997966 CCTCCATCAGGAGCCCCCCTGGG - Intergenic
900542115 1:3208189-3208211 GCTCCATCTGGAGCCCCGTGAGG - Intronic
900589466 1:3453352-3453374 CCTCCACCTGGAGCCGCCTGTGG - Intergenic
900744445 1:4351608-4351630 CCTGCATCTGGAGCAGCCCCAGG + Intergenic
900983543 1:6060058-6060080 CCACCATCTGATGCGCCCTCTGG + Intronic
903817549 1:26075787-26075809 CCTCTGCTTGGAGCACCCTCAGG + Intergenic
905791893 1:40794137-40794159 CCTTCACCTGGAGCTCACTCGGG - Intronic
907831752 1:58070918-58070940 TCTCCACCTGGATCACTCTCAGG - Intronic
915557569 1:156668978-156669000 CCTCCCTTTGGAGAAGCCTCTGG + Exonic
916483663 1:165237483-165237505 ACTCCATCTTGAACACCATCTGG + Intronic
920049183 1:203153013-203153035 CCACCCTCTGAAGCCCCCTCCGG + Intronic
920180721 1:204130297-204130319 CCTCCATGGGCAGCAGCCTCGGG - Intergenic
920243442 1:204570584-204570606 ACTCCATCTGGACCACCCTCTGG + Intergenic
923354674 1:233142566-233142588 CCTCCTTCTAGAGCTCACTCTGG + Intronic
924294477 1:242571219-242571241 CCTCCAGCTGCAGCACCTTCAGG - Intergenic
1062817213 10:509434-509456 TGTCCATCTGGAGCTGCCTCGGG - Intronic
1062971039 10:1649651-1649673 CCACCGACTGGAGCACACTCTGG - Intronic
1066076301 10:31881048-31881070 CCTCCATCTCTATCCCCCTCAGG + Intronic
1067070166 10:43125333-43125355 CCTCCAGCCGGACCCCCCTCTGG - Intronic
1067343363 10:45421401-45421423 CCTCTTTCTGGGGCACCCTCTGG + Intronic
1069887678 10:71634249-71634271 CCTCCTTCTGGGGCCCCTTCTGG - Intronic
1070557532 10:77540040-77540062 CCTCCATCTGGACCATCCCTTGG + Intronic
1070759902 10:79017601-79017623 CCTACATCTGGATCTGCCTCAGG - Intergenic
1070787258 10:79169132-79169154 CCTCCATCTGGCCCACCCTCAGG + Intronic
1071456318 10:85854090-85854112 CCTGGATCTGGAGGACACTCAGG + Intronic
1073550419 10:104395345-104395367 TCTCCATTTGGAGCAGTCTCTGG - Intronic
1074386260 10:113018983-113019005 CCTCCCTCTTGTGCTCCCTCTGG - Intronic
1075004550 10:118820568-118820590 TCTCCAGGTGTAGCACCCTCTGG - Intergenic
1075617594 10:123902979-123903001 CCACCACCTGGAGTACCCTCTGG + Intronic
1076510758 10:131012259-131012281 TCTCCAGTTGGACCACCCTCTGG - Intergenic
1076847446 10:133076239-133076261 CCCCCACCTTGGGCACCCTCAGG + Intronic
1077094937 11:795291-795313 CCTCCCGCTGCTGCACCCTCAGG - Intronic
1077133676 11:987836-987858 CCCCCATCTGGCTCAGCCTCAGG + Intronic
1077201342 11:1309136-1309158 CCTCCCTCTGGGGCACCATGGGG + Intronic
1079136850 11:17780267-17780289 CTTCCATCCGCAGCACCCACAGG + Intronic
1079366811 11:19816953-19816975 ACTCCACCTGGAGCCCTCTCTGG + Intronic
1083109683 11:60393149-60393171 GCTCCTTCTGGAGGACACTCTGG + Intronic
1083474637 11:62908186-62908208 ACTCCATCAGGATGACCCTCAGG - Intergenic
1084661097 11:70546814-70546836 CCTCCAGCTGCAGAACCTTCTGG + Intronic
1084899493 11:72299031-72299053 TCTCCATCTGGATGTCCCTCAGG + Intronic
1087372725 11:97305290-97305312 CTCCCTTCTGCAGCACCCTCAGG + Intergenic
1093941318 12:25057783-25057805 CCTCCACCTCTAGCACCCTAAGG + Intronic
1096024679 12:48350748-48350770 CCTCCAGCCGCAGCTCCCTCCGG + Exonic
1100666226 12:96756274-96756296 CCTCCTTCTTCAGAACCCTCAGG - Intronic
1103715797 12:122944716-122944738 CCTCCAGCTGGAGCAGGCTGTGG + Intronic
1103945370 12:124523252-124523274 CTTCCAACTGCAGCACCATCCGG + Intronic
1103985965 12:124767690-124767712 CCTCCCTCTGCAGCCCCCACAGG + Intergenic
1104375595 12:128263494-128263516 CCTCCATAAAGAGAACCCTCAGG + Intergenic
1105571785 13:21610435-21610457 CCCCCATCTGAAGCACTCCCAGG - Intergenic
1106479561 13:30126893-30126915 CCTCCTCCTGTCGCACCCTCTGG - Intergenic
1113880109 13:113620156-113620178 CCTCCATCTGCTCCACCCACAGG - Intronic
1113882228 13:113633688-113633710 TCTCCTTCTGGAACACACTCAGG + Intronic
1115438336 14:33402648-33402670 CCTCCAACTCCACCACCCTCAGG + Intronic
1115592041 14:34874317-34874339 CCTCCACCTGGAGAACGCGCGGG - Intronic
1116893654 14:50294144-50294166 CCTCCTGCTGGATCAGCCTCAGG + Exonic
1119615336 14:76095283-76095305 CCTGCATCTGAAGCACCTGCAGG + Intergenic
1120145967 14:80978659-80978681 CCTCCATCTGCAGCACCTGCAGG - Intronic
1122857317 14:104566069-104566091 CCTCCACCCGGCCCACCCTCAGG + Intronic
1123145850 14:106129411-106129433 CCTCCATCTGCACCTGCCTCTGG + Intergenic
1123159923 14:106268475-106268497 CCTCCATCTGCACCTGCCTCTGG + Intergenic
1123175207 14:106410364-106410386 CCTCCATCTGCACCTGCCTCCGG + Intergenic
1123193352 14:106592548-106592570 CCTCCATCTGCACCTGCCTCCGG + Intergenic
1123217737 14:106827731-106827753 CCTCCATGTGAACCTCCCTCTGG + Intergenic
1202943480 14_KI270726v1_random:5415-5437 CCTCCATCTGCACCTGCCTCCGG - Intergenic
1124719377 15:32098332-32098354 CCTGCTTTTGGAGCAGCCTCTGG + Intronic
1127334375 15:57969110-57969132 CTTCCATCTGGAGTGGCCTCAGG + Intronic
1127545837 15:59993961-59993983 CCACCACCTGGGCCACCCTCAGG - Intergenic
1127982778 15:64046560-64046582 CCCCCTGCTGGAGCCCCCTCCGG + Intronic
1129376845 15:75138899-75138921 CCTGCACCAGGAGCAGCCTCGGG + Intergenic
1131407379 15:92176425-92176447 CCTCCATCTGGAGCCCAGTTGGG - Intergenic
1131970938 15:97892170-97892192 CCTCCAGCTGGATCTACCTCGGG - Intergenic
1132553784 16:564095-564117 GCTGCTTCTGGAGCACACTCTGG + Exonic
1133502353 16:6378223-6378245 GCTCCATCTGCCGCACACTCGGG + Intronic
1133995094 16:10742010-10742032 CTGCCATCTGGAGCACAGTCTGG - Intergenic
1136172727 16:28498263-28498285 CCTCCAGCTGGAGGAACCCCTGG + Exonic
1136870525 16:33803324-33803346 CCTCCATCTGCACCTGCCTCCGG - Intergenic
1137946377 16:52736638-52736660 CATTCACCTGAAGCACCCTCTGG + Intergenic
1140035020 16:71365126-71365148 CCTCCATCTGGAGCACCCTCTGG - Intronic
1141002247 16:80319055-80319077 CTTCCATCTGGGGCACTCTTAGG + Intergenic
1142380210 16:89727662-89727684 GCTCCCTCTGGAGCTGCCTCAGG - Intronic
1203101647 16_KI270728v1_random:1312726-1312748 CCTCCATCTGCACCTGCCTCCGG + Intergenic
1142667152 17:1469714-1469736 CCTCCATCTGGAGACGCTTCCGG + Intronic
1142741698 17:1935279-1935301 TCTCCATCTCGCTCACCCTCGGG + Exonic
1142928497 17:3261615-3261637 CCTTCACCTGGAGCTCCTTCTGG + Intergenic
1143854980 17:9841850-9841872 CCTCCAGGTGGAGGACCTTCTGG + Intronic
1144228992 17:13180667-13180689 CCTCCATCAGCAGCAAACTCAGG - Intergenic
1147768903 17:42854542-42854564 CCTCCATCTCCAGCAGCTTCCGG - Exonic
1152100103 17:78296356-78296378 CCTCCCTCTGGGGGTCCCTCTGG + Intergenic
1156869774 18:41932051-41932073 GTTCCCTCTGGAGCTCCCTCTGG + Intergenic
1157625131 18:49044806-49044828 ACTCCATGAGGAGCAGCCTCGGG - Intronic
1161327007 19:3668839-3668861 CCTCCGCCTGGAACTCCCTCCGG - Intronic
1162564314 19:11436742-11436764 CCTCCATCTGCAGCACCTTCGGG - Intronic
1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG + Intronic
1162793985 19:13077327-13077349 CATCCTCCTGCAGCACCCTCCGG + Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1167260234 19:48454093-48454115 CTTCCATCTGGAACTCACTCTGG + Exonic
925599122 2:5590037-5590059 CCTCTGTCTGGAGCTCCGTCTGG - Intergenic
926523239 2:13943643-13943665 CCTTCATCTGTTGCTCCCTCTGG - Intergenic
927187168 2:20490214-20490236 CCTCCAGCAGCAGCATCCTCTGG - Intergenic
927653917 2:24929433-24929455 CCTCCAGGTGGGGCACTCTCTGG - Intergenic
927687795 2:25184128-25184150 GCTCCATCTCTGGCACCCTCGGG - Intergenic
927863182 2:26573229-26573251 CCTCCTTCTGGAGCTCACTAAGG - Intronic
929534438 2:42771695-42771717 CCACCATGTGCAGCACCCACAGG - Intronic
929900793 2:46001609-46001631 CCTCACTCCAGAGCACCCTCTGG - Intronic
931669945 2:64638107-64638129 CCTCCAGCTACAGCACTCTCAGG + Intronic
932637991 2:73409938-73409960 CCTCCAGCTGGAAGACCATCAGG + Intronic
932684546 2:73857159-73857181 CTTCCATCTGGGGCATCATCGGG - Intronic
932706168 2:74026448-74026470 GCTCCCTCTGGCTCACCCTCGGG - Intronic
934506604 2:94899235-94899257 CCTCCATCTTCAGCAAACTCTGG - Intergenic
934717884 2:96553735-96553757 CCTCCTTCAGGAGCAGCCTGTGG + Intergenic
938140981 2:128794411-128794433 CCTCCGTCTGCAGGCCCCTCAGG + Intergenic
941131112 2:161651342-161651364 TCTCCACCTGGCTCACCCTCCGG + Intronic
941876185 2:170435834-170435856 TCTCCCTCTGCTGCACCCTCTGG - Intronic
945665513 2:212736419-212736441 CCATCATCTGGAGCTCCCTTAGG - Intergenic
946317883 2:218930290-218930312 CGTCCCTCTGGAGAACCCTCTGG - Intergenic
946491955 2:220157211-220157233 CCTCCTTTTGGAGCATTCTCTGG + Intergenic
946572508 2:221040302-221040324 CCTCCAACTCAAGCACCATCAGG - Intergenic
948388786 2:237597781-237597803 CCTCCATCCAGGCCACCCTCCGG + Intronic
948593447 2:239065303-239065325 CCTTGGTCTGGAGCACCCACAGG + Intronic
1168761760 20:354365-354387 CCTCCACCCTGAGGACCCTCAGG - Exonic
1168813192 20:719674-719696 CCTCCAGCTGCAGCTCCCCCAGG - Intergenic
1169141221 20:3228380-3228402 TCTTCCTCTGGGGCACCCTCCGG + Exonic
1169207795 20:3749793-3749815 GCTCCAGCTGGTGCACCGTCAGG - Exonic
1170553216 20:17494768-17494790 CCTCCATCTGGCACATCCTCTGG + Exonic
1172012107 20:31851547-31851569 CCTCCATCTGCAGCACCACCAGG - Intronic
1172178820 20:32988324-32988346 CCTCCAACTCGGGCACCCCCAGG - Intronic
1172707281 20:36891470-36891492 CCTGTATCTTCAGCACCCTCTGG + Exonic
1172869459 20:38126692-38126714 CCTTCTTCCGGAGCACCCTGAGG - Intronic
1172896339 20:38302924-38302946 CCTCCCTCTGCAGCAGCCTCAGG - Intronic
1174393311 20:50231488-50231510 CCTCCAGCTGGAGCAACCTCTGG - Intergenic
1175901470 20:62361501-62361523 CCTCTATCTCTAACACCCTCGGG + Intronic
1178535035 21:33403790-33403812 CCCCCACCTGGGGCACCCGCAGG - Intronic
1180260315 21:46663847-46663869 TGTCCATCTGGGGGACCCTCTGG - Intronic
1182558928 22:31143785-31143807 CCTCCAGCCAGAGCACCATCAGG - Intergenic
1184079679 22:42210585-42210607 TCTCCATCTGCAGAACCTTCTGG + Exonic
1184095826 22:42315754-42315776 CCTCCACCTGGGGCTACCTCTGG - Intronic
1184266423 22:43349342-43349364 CATCCATTTGGAGCCCCCTCAGG + Intergenic
1185102163 22:48846473-48846495 CCATCATCTGGAACACCATCAGG - Intronic
949584340 3:5423309-5423331 CTTCCTTCTGGAGCTTCCTCTGG - Intergenic
951705542 3:25540700-25540722 CCTCCATCCACAGCACCCTGGGG - Intronic
954456666 3:50603356-50603378 CCTCCCTCTGGAACAACCTTCGG - Intergenic
962416922 3:135191809-135191831 CCTCCAGCTGCAGCACCTTCAGG + Intronic
965165457 3:165190140-165190162 CTTCCAGCTGGAGCTCCATCAGG + Exonic
966924927 3:184638514-184638536 CATCCATCTGCTGAACCCTCTGG - Intronic
967988488 3:195113833-195113855 CCGGCCTCAGGAGCACCCTCTGG - Intronic
968486797 4:866812-866834 CCTCCCCCAGGAGCAGCCTCGGG - Intronic
968489618 4:883061-883083 CCTCGGCCTCGAGCACCCTCTGG + Intronic
968555232 4:1243541-1243563 CCACCATCTGCACCACCCTGGGG + Intronic
968579034 4:1381179-1381201 CCTAAAGCTGGAGCATCCTCTGG - Intronic
969239535 4:5889455-5889477 CCTCCCTCTGGAGCAACATCTGG - Intronic
972233553 4:37102779-37102801 CCTCTATTTTGAGCTCCCTCAGG + Intergenic
972786254 4:42329210-42329232 CCTCCATATGGTGCATCCTCTGG - Intergenic
975477020 4:74834951-74834973 CCTCCAGTTGCAGCACCCTGAGG - Intergenic
975528584 4:75377546-75377568 CCTCCATCTGGCTGAGCCTCAGG + Intergenic
981563011 4:146067462-146067484 CCTCCAGCTGCAGAACCTTCTGG + Intergenic
982694353 4:158582538-158582560 CCTACATCTGCAGCACTCTGGGG + Intronic
983760961 4:171406099-171406121 CGTCTCTCTGGAGCACCCTGTGG - Intergenic
985589539 5:757428-757450 CCCCTCTCTGGAGCCCCCTCAGG + Intronic
985777830 5:1854158-1854180 ACTCCATCTGGAGCTCCCAGTGG + Intergenic
985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG + Intergenic
985827446 5:2203514-2203536 CCTCCAAAAGCAGCACCCTCAGG + Intergenic
986757593 5:10852676-10852698 CCTGAAACTGGAGCTCCCTCTGG + Intergenic
993693732 5:91035216-91035238 CCTCCCTCTTGAGCTGCCTCTGG + Intronic
994139090 5:96322270-96322292 CCAGCCTCTGTAGCACCCTCAGG - Intergenic
996701105 5:126451069-126451091 CCTACATCTGGAAAACCCACAGG + Intronic
996786454 5:127241884-127241906 TTTCCCTCTTGAGCACCCTCTGG + Intergenic
997463717 5:134072631-134072653 CCTGCAACTGGACCATCCTCAGG + Intergenic
998902207 5:146868248-146868270 CCTCCATCTGCAGCAGCTTTTGG + Intronic
999289532 5:150414755-150414777 CCTCCATCTGAAGCTCTCTAGGG - Intergenic
1001117040 5:168948422-168948444 CATCCATCTGCAGCCCCCTCAGG - Intronic
1002415847 5:179120652-179120674 CCGCGCTGTGGAGCACCCTCGGG + Intronic
1005400584 6:25429281-25429303 CATCCATCTGAAGCACCATATGG + Intronic
1005997186 6:30938632-30938654 CCTCCACAGGGAGCCCCCTCAGG + Intergenic
1013009339 6:106105585-106105607 GCTCCGGCTGGAGCAACCTCCGG - Exonic
1015910251 6:138162098-138162120 CCTCCTTCTGCAGCTTCCTCAGG - Exonic
1016417769 6:143851043-143851065 CCTCTGTCTGGAACATCCTCTGG - Intronic
1017280690 6:152621110-152621132 TCTCCTTCTGGGGCACCTTCTGG - Intronic
1017856852 6:158357097-158357119 ACCCCATCTGGAGGACGCTCGGG - Intronic
1018051431 6:160012430-160012452 TCTGCATCTGGAGAAGCCTCAGG + Intronic
1018164084 6:161077526-161077548 CCTGCAGCTGGAGCCCCCACAGG - Intronic
1019292893 7:258909-258931 CATCCAGCTCGAGCCCCCTCGGG + Intronic
1019523459 7:1470588-1470610 CCTCCATATGCAGGATCCTCAGG + Exonic
1020453452 7:8346075-8346097 TCTCCATCTGAAGCCACCTCAGG - Intergenic
1024222565 7:47299928-47299950 CCTGCATCTGGAGAAGCATCTGG + Intronic
1027136955 7:75631443-75631465 TCAGCATCTGGAGCAGCCTCAGG + Intronic
1032464407 7:132134813-132134835 CCTCCACCTTCAGAACCCTCAGG + Intronic
1032476054 7:132212122-132212144 CCTCCATCTGTGGCACTGTCTGG + Intronic
1034293042 7:149947484-149947506 GCTCCATCTGGTGCAACATCTGG - Intergenic
1034440965 7:151086056-151086078 CCTCGGTCAGCAGCACCCTCAGG + Intronic
1034461187 7:151198916-151198938 TCTCCATCTGGCGGAGCCTCTGG + Exonic
1034813031 7:154149389-154149411 GCTCCATCTGGTGCAACATCTGG + Intronic
1036778658 8:11630878-11630900 CCTCTGTCTGGAGCACCTTAAGG + Intergenic
1038162176 8:25050144-25050166 CCTCCCACTGGGGAACCCTCTGG - Intergenic
1039980641 8:42407143-42407165 GCTCCATCTGTAGCACCATCTGG + Intergenic
1040015549 8:42696284-42696306 CCTCCTTACCGAGCACCCTCTGG + Intergenic
1041022982 8:53657295-53657317 CCTCCTTCTGCAGCACCCATGGG - Intergenic
1049197244 8:141322652-141322674 CCCACACCTGGAGCACCCTCAGG + Intergenic
1049642939 8:143723520-143723542 CCTCCCTCGGCAGCCCCCTCAGG - Intergenic
1049688117 8:143947127-143947149 CCTCCACCTAGAGCACCCTGTGG + Intronic
1052027318 9:23588079-23588101 CCTCTGCATGGAGCACCCTCTGG + Intergenic
1053139535 9:35674070-35674092 CCTGCATCCGGGGCAACCTCTGG - Exonic
1055197444 9:73613402-73613424 CCACCATCTGGAGAACTGTCAGG - Intergenic
1056399511 9:86212967-86212989 ACTCCATCTGGAGCACAGTTAGG + Intergenic
1056782893 9:89564617-89564639 CCGTCATCTAGAGCTCCCTCTGG - Intergenic
1056926111 9:90835716-90835738 GCTCCATCTGAAGCAGCCACAGG + Intronic
1060103929 9:120862053-120862075 CCTCCCTCTGGGCCACCCTAGGG - Intronic
1061295930 9:129676723-129676745 TCTGCATCTGGAGGCCCCTCTGG - Intronic
1062026161 9:134341719-134341741 CCTCCATGGGGAGCACCATGGGG + Intronic
1062732767 9:138118975-138118997 CCACCCTCTGGAGAAGCCTCAGG - Intronic
1185591897 X:1282830-1282852 CCTGCATCTGGAGACCCATCTGG + Intronic
1186106859 X:6216534-6216556 CCCAAATCTGGAGCATCCTCAGG - Intronic
1186408984 X:9329288-9329310 CCTCCAACTTGAGCACTCTCTGG - Intergenic
1188751771 X:33913340-33913362 CTTCCATCTGGAGCATTGTCTGG + Intergenic
1189195351 X:39147891-39147913 TCTCCATGTGGAGCACCCAGTGG + Intergenic
1189421367 X:40861079-40861101 CCTCAACCTGGAGCAGCCACAGG - Intergenic
1194084598 X:89510165-89510187 CCTGCATTTGGTGCACCCACAGG + Intergenic
1196462820 X:115947481-115947503 CCCCAATCTGGAGCACCCAATGG + Intergenic
1197640092 X:128958299-128958321 TCTTCATCTGCACCACCCTCAGG + Intergenic
1198218695 X:134580012-134580034 CCGCCAATTGGAGCACCCTTGGG + Intronic
1198313050 X:135438596-135438618 CCTCCAGCTAGTGCACCCTCTGG - Intergenic
1199932735 X:152540759-152540781 CCTCCAGGTGCAGCACCTTCAGG - Intergenic
1200121409 X:153792728-153792750 AGTCCATCTGGAGCGCTCTCTGG - Intronic
1200437241 Y:3166051-3166073 CCTGCATTTGGTGCACCCACAGG + Intergenic
1201490599 Y:14537140-14537162 CCCAAATCTGGAGCATCCTCAGG + Intronic