ID: 1140037595

View in Genome Browser
Species Human (GRCh38)
Location 16:71383059-71383081
Sequence TGATAGCCAGAGGAATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140037595_1140037598 -6 Left 1140037595 16:71383059-71383081 CCTCCAAATTCCTCTGGCTATCA 0: 1
1: 0
2: 0
3: 9
4: 222
Right 1140037598 16:71383076-71383098 CTATCACCCAGTGATTCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 141
1140037595_1140037607 29 Left 1140037595 16:71383059-71383081 CCTCCAAATTCCTCTGGCTATCA 0: 1
1: 0
2: 0
3: 9
4: 222
Right 1140037607 16:71383111-71383133 CCGTATACTGGTCTCCCAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 26
1140037595_1140037605 26 Left 1140037595 16:71383059-71383081 CCTCCAAATTCCTCTGGCTATCA 0: 1
1: 0
2: 0
3: 9
4: 222
Right 1140037605 16:71383108-71383130 GCTCCGTATACTGGTCTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 50
1140037595_1140037604 17 Left 1140037595 16:71383059-71383081 CCTCCAAATTCCTCTGGCTATCA 0: 1
1: 0
2: 0
3: 9
4: 222
Right 1140037604 16:71383099-71383121 CACTGCTTAGCTCCGTATACTGG 0: 1
1: 0
2: 0
3: 4
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140037595 Original CRISPR TGATAGCCAGAGGAATTTGG AGG (reversed) Intronic
900809079 1:4787559-4787581 GGAATGACAGAGGAATTTGGTGG - Exonic
900894882 1:5476448-5476470 TAATAGCAAGTAGAATTTGGAGG - Intergenic
904927186 1:34058418-34058440 TGATAGCTATAGGAATGTAGAGG - Intronic
905210830 1:36373035-36373057 GGATAGCAAGATGGATTTGGGGG + Intronic
905298365 1:36969056-36969078 TGGGAGCCAGTGTAATTTGGGGG - Intronic
906766632 1:48440156-48440178 CGATAGCCAGAGGGTTTTTGTGG - Intronic
906827443 1:48996771-48996793 TTATAGCCAGAGGAAAATGTGGG + Intronic
909703686 1:78555071-78555093 TGAAAGCCAGAGAAGATTGGGGG + Intergenic
911721223 1:101193441-101193463 AGATAGCTAGAGACATTTGGTGG + Intergenic
917975841 1:180237114-180237136 GGATAGACAGAAGAAATTGGGGG - Intronic
918233736 1:182558858-182558880 ACATAGCAAAAGGAATTTGGTGG - Intronic
918829493 1:189374754-189374776 TGAGAGCCAGAGGACTTTCTTGG - Intergenic
919932209 1:202228718-202228740 TGAGGGCAAGAGGAATTGGGAGG + Intronic
922390442 1:225136479-225136501 TGAAAGCCAGAAGAGATTGGGGG - Intronic
922409547 1:225358306-225358328 TGATGGCCACAGGAACATGGTGG + Intronic
924116700 1:240754215-240754237 TCAGAGCCAGAGGAGGTTGGTGG - Intergenic
924549094 1:245057553-245057575 TAATAGCCAGATGTAGTTGGTGG + Intronic
1065088397 10:22203793-22203815 AGAAAGCCACAGGAATTTGTAGG - Intergenic
1068186437 10:53592341-53592363 TGAAAGCCAGAAGAGATTGGGGG - Intergenic
1069333905 10:67326550-67326572 TACAAGCCAGAGGAAATTGGGGG - Intronic
1072854641 10:98934603-98934625 TGCAAGCCAGAAGAAATTGGGGG - Intronic
1073326436 10:102646200-102646222 TGAAAGCCAGAGGACTGGGGAGG - Intronic
1073936663 10:108640653-108640675 TCCTAGCCAGGGGAGTTTGGTGG + Intergenic
1079530620 11:21447763-21447785 TCACAGCCAGAGGACTTGGGGGG - Intronic
1080633047 11:34097270-34097292 TGATAGCCAGAGTAATCCCGGGG - Exonic
1082266920 11:50129143-50129165 GGATCGCCAGTGGAGTTTGGGGG - Intergenic
1082289169 11:50349425-50349447 GGATCGCCAGTGGAGTTTGGGGG + Intergenic
1082774941 11:57237506-57237528 TGGTGGCCAGAGGAAAGTGGAGG - Intergenic
1084257204 11:67951210-67951232 TGAGAACCAGAGGGATGTGGTGG + Intergenic
1085328903 11:75630645-75630667 TGGTACCCAGAGAAATTTGAAGG - Intronic
1085787031 11:79462089-79462111 TGAGACCCAGAGGGATGTGGTGG + Intergenic
1085788354 11:79474619-79474641 TGGTGGCCAGAGGAACTTGGGGG + Intergenic
1086039925 11:82463850-82463872 TGAGAGCCAAAGGAATTGGATGG - Intergenic
1086560951 11:88168580-88168602 TGATAAGCAGAGAAATTTAGGGG - Intronic
1087769950 11:102197789-102197811 TGATAGCCAGAGGAAGAAGTTGG + Intronic
1088821443 11:113460791-113460813 TGAAAGCCAGAGAAACTGGGAGG + Intronic
1090430676 11:126643700-126643722 AGATAGGGAGAGGAGTTTGGAGG + Intronic
1091322237 11:134659917-134659939 GGATACACAGAGTAATTTGGTGG + Intergenic
1092512571 12:9172157-9172179 TGGAAGCCAGAAGAAATTGGGGG + Intronic
1093683972 12:22035372-22035394 AGATAGCTACAGGAATTTGTGGG - Intergenic
1095528365 12:43155146-43155168 TGAGAGCCAGAAGAACTTGGAGG + Intergenic
1095582567 12:43816709-43816731 TAAAAGCCTGAGAAATTTGGAGG - Intergenic
1096865094 12:54557925-54557947 TGAGAGAGAGAGGAATTGGGAGG - Intronic
1097756312 12:63410349-63410371 AGAAAGCCACAGGAAATTGGTGG + Intergenic
1098563742 12:71907538-71907560 TGATAGCCAGTTGAATTTTAAGG + Intronic
1098912871 12:76227958-76227980 TCATAGTCAAAGGAATTTTGAGG - Intergenic
1099148502 12:79078182-79078204 TGAGAGCCAGAGCAATGTTGGGG + Intronic
1100628037 12:96356771-96356793 TGAAAGTCAGAGGGATCTGGGGG - Intronic
1104482471 12:129120066-129120088 TGAAAGAGAGAGGAAGTTGGAGG + Intronic
1104870458 12:131991528-131991550 TCTTATCCAGAGGAATTTGTAGG + Intronic
1107190998 13:37585725-37585747 TGATACACATAAGAATTTGGTGG - Intronic
1108501261 13:51071966-51071988 TGATGGGCAGGGGTATTTGGTGG - Intergenic
1108692539 13:52872157-52872179 AGAGAGGCAGAGGAAATTGGAGG - Intergenic
1108710093 13:53024780-53024802 AGATGGCAAGAGGAATTTAGAGG + Intergenic
1110705443 13:78598798-78598820 TCAGGGACAGAGGAATTTGGAGG - Exonic
1114717954 14:24848019-24848041 TGTTAGCCATAAGAATTGGGGGG - Intronic
1115788160 14:36849277-36849299 TGATACGAAGAGGACTTTGGGGG + Intronic
1116312134 14:43340970-43340992 TGCAAGCCAGAAGAGTTTGGGGG - Intergenic
1117097833 14:52315331-52315353 TGATAGCCAGGAGAATGAGGTGG - Exonic
1117144305 14:52821571-52821593 TAATAGCCAGATGAAGGTGGCGG + Intergenic
1117790803 14:59339742-59339764 TGCAATCCATAGGAATTTGGGGG + Intronic
1118107050 14:62671680-62671702 GGATAGACAGAGGAATTGGGAGG + Intergenic
1119563449 14:75608892-75608914 TGATAGCCAGGGGACTGTGTGGG - Intronic
1120176897 14:81304053-81304075 AGAAAATCAGAGGAATTTGGTGG - Intronic
1121007762 14:90501150-90501172 TGATAGCCAGAGGAAGCTCCGGG - Intergenic
1125425394 15:39543486-39543508 TGATAGCCAGAGGACTTCCTTGG + Intergenic
1126124446 15:45282896-45282918 TGAAAGCCAGAGGAGTTCTGTGG + Intergenic
1126814699 15:52443091-52443113 TGATACCAAGAACAATTTGGGGG - Intronic
1127217233 15:56836101-56836123 TGTGAGCCTGAGGCATTTGGAGG + Intronic
1127763159 15:62160691-62160713 GAATAGCCAGAGCAATTTTGAGG + Intergenic
1130315288 15:82790229-82790251 TGATGGCCAGAGGAGTTGGCTGG + Intronic
1131067529 15:89443694-89443716 TGATAACCCTAGGGATTTGGGGG - Intergenic
1131988126 15:98065562-98065584 TGAAATCCAGAGCAATTTGTGGG - Intergenic
1134346332 16:13395149-13395171 TGCTCGCCATAAGAATTTGGAGG + Intergenic
1134363777 16:13557494-13557516 TCATAGCAAGATTAATTTGGGGG + Intergenic
1134659985 16:15976845-15976867 TGAAAGCCAGAGAGATTGGGTGG + Intronic
1138926624 16:61599553-61599575 GGAAAGCAAGAGGAAATTGGGGG - Intergenic
1140037595 16:71383059-71383081 TGATAGCCAGAGGAATTTGGAGG - Intronic
1140899727 16:79356673-79356695 TGAGAGCCAGTGGAAAGTGGGGG - Intergenic
1141488566 16:84356641-84356663 TGAGAGCCAGAGGACCTTGTGGG - Intergenic
1142887819 17:2924164-2924186 TGAGAGCCAGGTGATTTTGGAGG + Intronic
1143147975 17:4789056-4789078 AGATAGCGAGAGGAATTGAGTGG - Exonic
1143254793 17:5547994-5548016 GGTTAGCCAGAGGAATGTGATGG - Intronic
1143569685 17:7748394-7748416 GGAAAGCCAGAGGAATTGAGTGG - Intronic
1147710361 17:42459040-42459062 TGATTGTCAGAGGAATTAGCGGG + Intronic
1147710405 17:42459209-42459231 GGATAGGCAGAAGAATTTAGGGG + Intronic
1147948957 17:44096349-44096371 TGGTAGCCAGAAGGATTTCGGGG - Intronic
1150698312 17:67425068-67425090 GGATAGGCGGTGGAATTTGGAGG - Intronic
1151381636 17:73729902-73729924 AGATGGCCAGAGAAATCTGGGGG + Intergenic
1153440749 18:5116755-5116777 TAATAGGCAGAAGAGTTTGGAGG + Intergenic
1153557974 18:6336671-6336693 TGCAAGGCAGATGAATTTGGGGG - Intronic
1157303067 18:46494074-46494096 TGAGAGCCTGGGGATTTTGGAGG - Intronic
1157458758 18:47864681-47864703 AGATTTTCAGAGGAATTTGGGGG - Intronic
1157918446 18:51692521-51692543 TATAAGCCAGTGGAATTTGGGGG + Intergenic
1158127065 18:54112280-54112302 TCCTAGCCAGAGGAATCAGGGGG - Intergenic
1158563943 18:58538359-58538381 TAATAGCTAGAGGGAGTTGGGGG - Intronic
1158881181 18:61780922-61780944 TGATAGGCATTGGAAGTTGGGGG + Intergenic
1159791416 18:72783843-72783865 TGAGTGCAAGAGGAATTTTGTGG - Exonic
1163910466 19:20186602-20186624 TGATAGCCAAAGCAATCTTGAGG - Intronic
1163932340 19:20408403-20408425 TGATAGCCAAAGCAATCTTGAGG + Intergenic
1164792118 19:30996251-30996273 TGATAAGCAAAGGAATTGGGTGG + Intergenic
1164933150 19:32190782-32190804 TAATAGGCAAGGGAATTTGGGGG - Intergenic
927653762 2:24928545-24928567 TCATTGCTAGAGGAATTGGGGGG + Intergenic
928781747 2:34831067-34831089 TCAGAGACAGAGGACTTTGGGGG - Intergenic
931544267 2:63363829-63363851 TGATAAAAAGTGGAATTTGGAGG - Intronic
931921360 2:67019640-67019662 TGCAAGCCAGAAGAAATTGGGGG + Intergenic
932594678 2:73086654-73086676 AGCCAGCCAGAGGTATTTGGAGG - Intronic
932781635 2:74562216-74562238 TGATAGCCTTAAGAATGTGGAGG - Exonic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
934541996 2:95183265-95183287 AGAAAGCTAGAGGAATTTGTAGG + Intronic
935097409 2:99958780-99958802 TGGGAGCCAGAGGATTTTTGAGG + Intronic
936795783 2:116202897-116202919 TGCAAGCCAGAGGAGATTGGGGG - Intergenic
937842907 2:126543309-126543331 TGCAAGCCAGAGGAAAATGGAGG + Intergenic
938887654 2:135669298-135669320 TGGTAGCCACATGAACTTGGGGG - Intronic
942528447 2:176881709-176881731 TAACAGCCAGAGGGATTTGCTGG - Intergenic
942586336 2:177483084-177483106 TGATATCCAGAGCAGTGTGGAGG + Intronic
942669440 2:178358281-178358303 TGATAACCAGAGCAACCTGGGGG + Intronic
943991055 2:194693098-194693120 TGATATCCTGAGGAATTTGTTGG + Intergenic
944941363 2:204632023-204632045 TAGTAGCCAGAGCAATTTGTTGG + Intronic
1169743000 20:8915544-8915566 GGATAGCCAGAGAGATTTAGGGG - Intronic
1170467363 20:16635014-16635036 TCATAGCCATAGGAATTCTGTGG + Intergenic
1171819727 20:29823709-29823731 TCAGAGCCAGTGGAATGTGGAGG - Intergenic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1175700656 20:61134599-61134621 AAAAAGCCAGAGGAATCTGGAGG - Intergenic
1176725537 21:10429110-10429132 TGAAAGCCACAGGCATTGGGTGG + Intergenic
1178347986 21:31848612-31848634 TGAGAGCCAGAGGACCTGGGTGG - Intergenic
1178554258 21:33573727-33573749 TGAAATCCAGTTGAATTTGGAGG - Intronic
1178715203 21:34958047-34958069 TGAAAGACAGACAAATTTGGGGG + Intronic
1178987940 21:37324716-37324738 TGAAAGCCAGAAGGAATTGGAGG - Intergenic
1180323729 22:11348400-11348422 TCAGAGCCAGTGGAATGTGGAGG - Intergenic
1182920627 22:34075881-34075903 TGAGAGCCTGAGCATTTTGGAGG + Intergenic
1184874339 22:47263653-47263675 GGTTAGCCAGGGGACTTTGGTGG + Intergenic
1185264771 22:49895210-49895232 TGAGAGGCAGAGGCATTTGCAGG + Intergenic
950229194 3:11261206-11261228 TAATAGCCAAAGGAAATTTGGGG - Exonic
952006136 3:28844836-28844858 TGAGAGCCACAGGGATTTGTCGG + Intergenic
952841171 3:37646749-37646771 TGTTTGCCAGAGGACTTAGGAGG + Intronic
953266767 3:41397447-41397469 TCATATCCAGAGGCTTTTGGTGG - Intronic
954692626 3:52403749-52403771 TGATGGACAGAGGAATTGAGAGG + Exonic
955772843 3:62403669-62403691 TGAGAGCCTTAGGAATTTAGGGG + Intronic
956371996 3:68572737-68572759 TGCAAGCCAGAAGAGTTTGGGGG + Intergenic
957087208 3:75692246-75692268 TCAGAGCCAGTGGAATGTGGAGG + Intergenic
957460674 3:80515048-80515070 TGAAAGACACAGGAATTGGGAGG - Intergenic
957540768 3:81566127-81566149 GCATAGCAAGAGGATTTTGGAGG - Intronic
960067234 3:113387157-113387179 TCAGAGCCAGTGGATTTTGGAGG + Intronic
961521257 3:127468581-127468603 AGGTAGCCACAGGAATATGGAGG + Intergenic
962899540 3:139746978-139747000 TGATAGCCAGACCAATGAGGTGG - Intergenic
964060072 3:152511029-152511051 TGAAAGACACAGGAACTTGGGGG - Intergenic
964561582 3:158002581-158002603 TGATAGCCAGAGTAATAAAGAGG - Intergenic
965029626 3:163348538-163348560 TGATTGCCAGAGGTAAATGGTGG + Intergenic
966490150 3:180518286-180518308 TGTAAGCCAGAAGAAATTGGGGG + Intergenic
967373298 3:188772801-188772823 TGATAGTGAGGGGGATTTGGGGG + Intronic
969851396 4:9959915-9959937 TGACTGCTAGATGAATTTGGTGG + Intronic
969952432 4:10852436-10852458 TGCAAGCCAGAAGAATTTGGGGG - Intergenic
970857691 4:20667622-20667644 TAAGAGCCAGAGGAATCTGCTGG + Intergenic
971578417 4:28305166-28305188 TGATAGCCAGGGGAGTTCTGTGG - Intergenic
972021582 4:34322750-34322772 TGATAGCCAGTAGACTTGGGGGG + Intergenic
972080945 4:35148101-35148123 GGATAGGGAGAGGAATATGGAGG + Intergenic
972248357 4:37271199-37271221 GGATAGCCAGAAGAATCTGGTGG - Intronic
973973707 4:56241451-56241473 TTAGAGGCAGAGGAATTGGGAGG - Intronic
976010618 4:80483566-80483588 TTATAGCCAGAGGAAGTATGAGG + Intronic
976568951 4:86586388-86586410 AGACAGAGAGAGGAATTTGGTGG - Intronic
976727532 4:88229270-88229292 TGATAGTCAGAGGAGTGTGCAGG - Intronic
978464310 4:108992181-108992203 TAATTGCCTTAGGAATTTGGAGG - Intronic
979057229 4:116012309-116012331 TGATTGTCAAAGGAATTTTGGGG - Intergenic
980290953 4:130847059-130847081 TGATAGCCAGGGGTGTTTTGTGG + Intergenic
982891895 4:160864376-160864398 TGATAGCCAGAGGAGTTGCCTGG - Intergenic
983015149 4:162604447-162604469 TGAAAGTCAGGAGAATTTGGGGG - Intergenic
984196751 4:176666391-176666413 TGAAAGCCACAGAAATCTGGGGG - Intergenic
986777784 5:11034417-11034439 TTTTACTCAGAGGAATTTGGTGG - Intronic
988499543 5:31772994-31773016 TGTGAGACAGAGGACTTTGGAGG + Intronic
989515449 5:42337601-42337623 AGATAGGCTGAGGAAGTTGGTGG - Intergenic
990329417 5:54711395-54711417 TGATAGCCAAAGGATTTTCTGGG - Intergenic
991297114 5:65093204-65093226 TGAGAGCCAGTGGAGTTGGGAGG + Intergenic
991924976 5:71696691-71696713 AGAAAACAAGAGGAATTTGGTGG - Intergenic
993251541 5:85531087-85531109 TGATTGCCAGAGGTTTGTGGGGG - Intergenic
994156149 5:96506423-96506445 TATTAGCAAGAGGAAGTTGGAGG + Intergenic
995656178 5:114428736-114428758 TGATTGCCAGGGGATTATGGGGG - Intronic
997563801 5:134871824-134871846 AGATAGCAAGACAAATTTGGCGG + Intergenic
999541990 5:152584361-152584383 TGATAAGCAGAGGAAGGTGGGGG + Intergenic
1002585631 5:180245187-180245209 TGTTAGACAGTGGAATTTAGGGG - Intronic
1004531297 6:16457849-16457871 TGATAGCCTGAGGGGTTTGGTGG - Intronic
1006285029 6:33086123-33086145 TGATGGGCAATGGAATTTGGTGG + Intronic
1007056534 6:38891537-38891559 TTATTGGAAGAGGAATTTGGGGG + Intronic
1007430562 6:41774279-41774301 TGTTAGGCAGAGGAAGATGGGGG - Intronic
1008540666 6:52544190-52544212 AAATACCCAGAGGAATTTGAAGG - Intronic
1011007111 6:82657902-82657924 TGATAGACATTCGAATTTGGAGG - Intergenic
1012342058 6:98139448-98139470 TGGCAGACAGAGGAAATTGGGGG + Intergenic
1015566826 6:134581430-134581452 TCTTAGCAAGAGGAATTTAGTGG + Intergenic
1016054799 6:139567240-139567262 TCATAGCCAGTGGACTTGGGGGG - Intergenic
1017096936 6:150812876-150812898 TGAAAGACAGAGGAACTTTGAGG + Intronic
1021312216 7:19108925-19108947 TGATACCAAGAGCAGTTTGGTGG - Intronic
1021832079 7:24624374-24624396 TGAAAGCAAGAGTCATTTGGGGG - Intronic
1023789947 7:43746055-43746077 TGAAAGCCTGAGGAATTTGTGGG + Intergenic
1026549238 7:71353068-71353090 TGCTAGCCTGAGGGCTTTGGGGG + Intronic
1027785969 7:82579184-82579206 TGTGAGCCAGAGGGAATTGGTGG + Intergenic
1027800481 7:82744110-82744132 TGATAGCCAGAGGCCCTTTGTGG + Intergenic
1027996057 7:85426805-85426827 TGAAAGCCAGAGGACTAGGGTGG + Intergenic
1030240164 7:107313815-107313837 TCATAGCAAGAGGGATTTTGCGG - Intronic
1030997683 7:116378130-116378152 TGGTTGACAGAGGAATTTTGTGG - Intronic
1031673605 7:124581846-124581868 TGATAACCATATGAGTTTGGAGG + Intergenic
1032049834 7:128641187-128641209 TGGTAGCCTGAGTAATTTTGAGG - Intergenic
1034073505 7:148210097-148210119 TGCTAGCCAGAGGAAAATAGAGG + Intronic
1034612339 7:152382466-152382488 TGAAAGCCACAGGCATTGGGTGG - Intronic
1035907657 8:3531238-3531260 TAAAAGCCAGAGGAAATGGGAGG - Intronic
1036727374 8:11231795-11231817 GGAAAGAAAGAGGAATTTGGGGG + Intergenic
1037404400 8:18526026-18526048 TTGTAGCCATAGGAATTTAGGGG - Intergenic
1037608848 8:20459525-20459547 TTAGAGCCAGAGGGAGTTGGAGG - Intergenic
1037730590 8:21520339-21520361 TGACAGCCATAGGAAGTTTGGGG - Intergenic
1039032347 8:33324192-33324214 TTCTAGCCAGAGGAATGTGTGGG - Intergenic
1042038859 8:64570522-64570544 TTATAGGCAATGGAATTTGGAGG + Intergenic
1042649955 8:71028919-71028941 AGAGAGACAGAGAAATTTGGAGG + Intergenic
1044294418 8:90511051-90511073 TGAAAGGAGGAGGAATTTGGAGG + Intergenic
1045686101 8:104713960-104713982 ACACAGCCAGAGCAATTTGGAGG - Intronic
1047351232 8:124076511-124076533 TGGTCCCCTGAGGAATTTGGTGG + Intronic
1047552354 8:125888715-125888737 TGAAAGCCAAAGCAAATTGGAGG - Intergenic
1047561070 8:125988598-125988620 TGAGAGGAAGAGGAATCTGGGGG + Intergenic
1050043162 9:1516574-1516596 TGATAGCAAGATAAATATGGAGG + Intergenic
1050729915 9:8697271-8697293 TAATAGCCAGAGAAATCTAGAGG + Intronic
1053750660 9:41251266-41251288 TCAGAGCCAGTGGAATGTGGAGG + Intergenic
1054256171 9:62815609-62815631 TCAGAGCCAGTGGAATGTGGAGG + Intergenic
1054335133 9:63800005-63800027 TCAGAGCCAGTGGAATGTGGAGG - Intergenic
1056205235 9:84313521-84313543 AAATACCTAGAGGAATTTGGAGG + Intronic
1057140172 9:92721950-92721972 TGAGACTCAGAGGATTTTGGTGG + Intronic
1061348552 9:130045250-130045272 TAATAGCCAGAGTGAGTTGGAGG + Intergenic
1203371401 Un_KI270442v1:308974-308996 TCAGAGCCAGTGGAATGTGGAGG - Intergenic
1190063488 X:47225193-47225215 TGAAAGCCAGAGTGTTTTGGGGG - Intronic
1192004833 X:67199336-67199358 TGAGAGCCAGAGGAGGTTGGGGG + Intergenic
1193496758 X:82222239-82222261 TAATAGCCAAAGCAATTAGGAGG - Intergenic
1196007214 X:110849772-110849794 TGGAAGGCAGAGGAGTTTGGTGG - Intergenic
1196254297 X:113497704-113497726 TGAGAGCCAGACTCATTTGGGGG + Intergenic
1198443495 X:136688082-136688104 AGATAGCAAGAGAATTTTGGGGG + Intronic
1201066943 Y:10106109-10106131 TCAGAGCCAGTGGAATGTGGAGG + Intergenic